Danio_rerio Locus Mono:35:SNORA50
snOPY snoRNA Orthological Gene Database
Danio_rerio Mono:35:SNORA50
Danio_rerio
Mono:35:SNORA50
3
SNORA50
1001..1135
2135
CTAATATATTGCGTTAATGAGCACGTGTTCGCAGCGTGACTGGTCTCATTCACTGAGGA
TTGAGGTAAAGTTGATTGTATATTCACACTTTCAGACTTTCTCCTTAATATAATTCCTGA
AATGTATTATTTCTTTTTAGGCAAATTTTGAATAACGAACTCATATTATGATTATGAAAG
TATGTTGTTCACAGTCAAATAAGTAGTGTCAAAGTCGTTTTCAAGTCGTTCTTGCATGTG
ATTTCAGACCAAATATTCAAAGTAAACAATATAGGCGAGCGCATCACAAGTTCTCATTGA
TAATAATCATTTTCAGGGATTATATTGAGGAGAGAGTCTGAGTGTGAATATAAAACCAAC
TTTACCTTAATTAACTGAGTGTTTTTCTAAGTAAATTATTTAATGTAGAATTTTATAACA
CTTAAGTGATGTTCTACCTCTCTTTTCAGGTTGTTTGCAGTTGCAGTGGACTACATCGAG
ATTCTATTTGGTGTTAACCAACTTGGAAACAGACCAATCAATCTAACAGGGTAGTTCACC
CAAACATGAAAATTGTAAATTAACTTTTCAAATACTGAGTTTCTTCTGTTAGAAATAAAA
AATATGTATTTTGAAGAAAGCTGGAAGCTTAACTATTCACTTCTATAGCAAATAAAATAA
ATGCTATGGAAGTCAATTATTACATAATTTCAGCTTTCTTCAAAATTCATCTTGTGTTCA
AGAGAAGAAATTGAAACCAATTGATGTTTAGTAAATTTTTATCTACTATTCCTTAAGTGT
CTTTTGATCTCAGAGTTAACTTGCTGTTATGACATTCATTGGAACAGGTTGAGGTTTGTA
GTTTTTACACTGTGCTGTTAACTTTAATGCTTAGTGGTTAATTTAATTGCATTGTTTTTT
TGTTACTTTGTCATTGTATCTGAACAATTCTGTTTGTCTTGCTGTATGTAATAAAGAAAA
TTGAGCACTATATTTGTGAATGGTAATTATTACACTCTATAAAGCACTGTCTTTGAACCT
GTGTAGCCCATCCATGGCTCAGCGGGCCAAGCAACAGTGCAACAGTAAAGGGTTGTTATA
ACTGGAGCCCCTTGGCTTTTCTTCCCAAGTTGCTCTTTTAAAAGCAACCTACAAATGACG
TTTTCAAATTGTTAGTACAATTGAGAAAAAACAAACACCACAACTAGAGTTATTTTGCAA
AAGCCGTTGATCAGTTTCTACACACAATCATGTTGTCTGTATGGCCAAACACAATATTAA
CATGAAATATTGTGCAAAAGAAATAACAATTGGTAAAGCCACTAAAAACAAACAGCGAAT
GGCAACATTTTAGCGTAAACAATGATACAAAATAATCACGTTAAAATCAAAGTACATCAT
ATTTGGAGTAGAGTCCAAAACTCTGGTGGAAAAAGCAATTTATGTTTGCTGACACCTTAG
TACCAGCTAAGATACAGACCTTGTCATGTATGTTGGCTATAAAACACTTCAGAATTGTCA
ATTCCTCCTAAACATATGATAATGGTTGAATGTCAAAACTCATTCATAGAATTGATGGCA
AAGGTTACTTGCCAATGATTATTCAACAAAAACTACATGATTTAATACACCACATGATCT
TGCAAACAGAAAAACAATGAAGAAACAAAGCCAACCTGGCAATGAACAACACAGATATCA
TCACTTGTATAAGCCAAAGATAGACGAAAATGCTTTGTACATTCAACAATCTTCTCCACT
TGCGCACAACATATGAGCTCATCTGTATTGAAAATAGAATAGCACTTATTTTGAGCACTG
ATCTGAAAATATGATGCGAGGTCTAGCCCAGTGGTTCTCAATGGTCTTGCTTCAATACCC
AGATTTTACAAATCCTGGAATATTTTAAAATGACTGTGCAAAATAATTTTAAAGACAGGT
TAAGCAGGAACATCTACAATTATAGTTATTGACTGTAACCGTCAACAATGGGTCAGCGCA
AGCTTTTTTGTTTTAAGAGAGTAACACCATAGAGTTCTGTGCAAAAGTCTTGATTTGTCG
TTTAAGCAGTAGTATATTTATCATGTATAATTACCTCTCTATTTTTTTACTTCAACATAA
TTGAGATGAAGTCTATTAGACAAATAAGGAAAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007114.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved