Danio_rerio Locus Mono:20:SNORD94
snOPY snoRNA Orthological Gene Database
Danio_rerio Mono:20:SNORD94
Danio_rerio
Mono:20:SNORD94
24
SNORD94
1001..1092
2092
GTACTATGACGTCTTGCAGTTTTTGTTTTCACGGTGTATATTTATGACAATCTCAACTA
TGTTACTTGAGGATTGTTTTCTCATATGTGCCATTTCCACGTATGAGAACCGTCCTTTGT
CAGACTCGAATCATACCTGCCAAAACTCCCATATTTCACACTCATTTCCCCCCCCCGCCA
CCCTCCCGTTTTGTTACTCCTGTAATTTGAATGACCCGATCTGGTTATGAAAAATCCCTT
TATGTCCATGTTTGTCAAGTTGCCAAATCTTGTATGACGCTCATTACTTCACACAATTGA
CAAAATATTCAAATCTCAAAGCATTTTTTACCTCAATCTGGCAACATACGTTATAACCCA
GTTGCGCTGTTGATTTCTGCAGAGGTGGAAGATGCAGGATTTGAACAGCGGTGGTAGCAA
CATCAGTAGCAGATCATCAGTTATAATATTTAATAACCTCCCTGCTCTCAAATTTGGAAG
ACAAATGTTTGGAAGACACTGGTCTGACACCGTACAAGGTGAGCTCCCGAGCAAACTGAC
CACACCAGAAAAGCTGTGCATACTGAGGTATTCAGCCAACAGTAGTGCAAAAAGGAAGTT
GCCAGTGGGTTCATAAAGCCCCATAGCAATTGTTTTACACACAAAATCCAGCCATATGTA
GCCTAGTGCACATATTTCTGAACTTAAAACTCTGAAAACTGAACACAGTTTCAAATAACT
TTAATCTTCTATGTGAAGCTGCTTTGACAAAATCTACATTGTAATAGCGATATACAAGTA
AAGGTGAATTGAACTGAATTGAATTTCACAGTTCTCAAATATGTAGCCCTGGGCACATCT
TCCCAATGAGACTGTGTTATGAAATATCCTTGCTCTGTTATACATCATTTATAATATTAG
AATATAAAAACAAAACACATTTCTCAGGAGGGCTAATAATGCTGTCTTCAACTGTACACA
TTTATTATGTTTTCTATTTCTAACACGGAAGGATCGTCAGGAGGGCAGTGCTGATTGGCG
CAGGGGTGACGGAGCACAGATGCATGCTGGGAAGTGTGGTTTTCTGCAGAACTCTACTGT
TCTACCTCGTCCTGCTGCTCGTGTGCTGTGTTCTGGTTCTGCAGACTGGAGCTGTGTGCT
TCGCTCTGGTTCTTCCTCCTGATGGAGCTACGAGACTCATCGGTGATGCTCTGAATCTGA
GCAGTGTTTCCCCCCCGAGAGCAGCACAAATTAAAGAGGAGCACAGATCAACAAAACACC
AGCCGCCAGCCAATCCTTCCAGATTGACAGCCAACACACGTCTAGACCAGTTACACTCAC
AAACTAGACGCAAGATACCAATGTTTTTTTTTAATACTTCAGTTATTTTGCATGCTTAAC
TTTTTTGATATCATCATAACACAATAATTGTCATTGCTGAAATGCAAATATGACATGAAC
CATATGTATTTTTAGCCTGAAATTAGCATAAAGTTTATTAATAAATTAATTTGACAATAA
TAATGTTACTATTGCTACTATTAATACAGGGGCGGGCTTAGTGATTTGGGGGCCCTAAGC
AATTCCAGGTATGAGGCCCTATCATCACAACTCAAAACACTCTATTTTTTTATAGATATT
ATTTTCTTCTGTATATTCATTTTTATTTTTTGTAAATAAACTGCATGTTAAAAATATATT
TCAAGTGGAATCTTTATTTTCTTAATGTAAAATTAAATACAACAGATTCACAAATATAAA
AAAATAATAATTCACAAATTAACGGTGCCCAGTTAATTTTTCTGGTTAGATTGTAATATT
AAAATCTAACCAGAAGGGTTTGAAAATAAGTAATAACATTAAAATCGTAATGGTTATAGA
CAGATTTTATAAAAGAGTTCTATGATTAATATATTGGTTAGAGCCCCCTAATTGCCCGGG
GCCCTAAGTGGCTGCTTGCTTCTCTTATTGGTTAAGTCCACCCCTATACTTACAATTAAA
TAATAATGATAATAATAATGCATTATTTTATTTACTTGACATTAAATAATAATAATAATA
ATAATAATAATAATAATACATTATTTTATTTATTTGACATTAAATAACATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007135.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved