Danio_rerio Locus rpl32
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl32
Danio_rerio
rpl32
22
SNORA7
5417..5555
6977
GTTATCAATGTTGTAAACTTAACTATAATAGCATCACAGACCATATTCCTTTTTGGGAC
ATTTTTTACAGAATACATGTTTTCATTATTACCTTGTGTGAATAAATAAAAGGAGTTTTC
ATAACCCTTTTATGTGAAGTCTGGGGCCCCTAAGTTAAATTTAATGGTTTGGGTATGGAT
ATGAACCCAAAAACTAATAAACGTTCAACAAAGAAAAAATGTTATAATCATCAATAATAT
TTTAGGTCAATTTTTAAGCTTTAAAGTACTTTTCTTTTCCAGAAAAAAAAATAAAGTTAT
ATTGGATTATACACTTTATTTCATCATTTGAAAATAAGGGTAGATAACTGGAATACAATT
TCCCACATGAAAAATTGCTATATAGTAATCCATCGTAAATACAGAGTTTCAGAAGTACTG
TAAAACAGGTACTAGGCTGTAGAAATAAACATAATAAACTTTTGGTTTTTAAAAGTTTTG
CTACAGTATTTTATTTATTTATTAAACAAACTCACAGCCAGCTGTAGCATAAATTTACAA
AGTTATTAATATTGTAATATCCACAGTAAATCACTTAACAGTATGGATTTAAATATTGTA
CATTACTACAGTAAGTTATTTATTTCATTTTGTTTGAGTTGTGTCAAACAATAAAAATAT
CTCATTGAAATACCGAATTTAAACTTATTTTTCATTAGTATTTGAAATTGTTTTAGTCTC
CTCTAGAAAATTCCAAAGCATTTCCTTCAGAGACATTACAGGCGTCTTGAAAAACAAATA
TTTGTTATTTAGCATTGTAACAGACTGCCAGAGGGAAGTTATAAACAGGAATTAACTTAT
GAACTTTTGGTAATTCACATTTGTATAATATTTCATTTTAGCCTCACCTTTTCCACTTAT
AATTTTGACAACACATCGACAGTCGTGTACGGTTACATTTGAGAGCAGGAGCAACTTCCG
CTGACCGGTTTTATTTCCAGGCCGTCGCTGCGTCACTTCCTTCTCTTCTTCAGGACTGTC
TTCGCTAGAGACAGGCTGAAACGGTGAGCGGAATAACATCTCAATACATCCTTACACATC
ATAATTCAAATAAACATTTAAGGTGCTGTGACGTTTTATTTATGCGTGCTGCTTATAAAT
CCGCCAATATTGTGGCTGTTAAAGCGACAGTATATTGGATATTTATATGAAATATCACAC
AACGTCCGTACATGGCGGCCATTAGTGTGATGAAGGCGAGTCTCAAAGCTTAAAAATGTA
AATTAAAGCTTAGCTCACTTCTCGTTTTCATACTGCAATACACTGTTTTTTCTAAAAAAT
AATGTATTTACACTGTTAAGCGGTGAATTGTTGAATACTTGTGTGGGTTGCATATGTTTA
GCATATGTTACCGTTTCGTCCATAACGTTAGTTTAATTCTCCTTCCTAATAATAAATGAT
TGGCTGCTTTGAGATAAATTAGTGTTTTGAGCGTTGCAATTTTGCCTTTTGTTGACGCAT
CGTAGGCTAAAGTTTACTTTTAGCTAACATCGCTAATTTTCCTGATTCAAAAGCGAGATG
TGCCGTGTTATATAATAATATATTTATAATATGTAACTTTAACGTAAACTGTGTGACCTT
AGAGTATTTGCATTGAAAACTTAAATGTAGGCCCAGTGTCTGTATATTGCATGTCTACAT
TACAGATAGCTTTAAAGAGTGGTTGTATTAAAAAATACCATGACCTTCATTAAGTGTAAT
ATGTTTATGAAGGATTTATGGATGACTTAATAAAGCTTTCCCTCCCCGTTTTTACTAGAA
GGAACCTGATTACAATTTTGTGACTGCTATTTGTCATCAAGTAGTTCCTATGCTAAATGT
CATTAATATTATTATTTTGATTTAGGTGAAGTTGGTTTTATATTCACACATGTAGTTTTC
TCTTTAATATAACGTTAATTTCATTAAAGTATTCTTTGCATATTTTGAATAGGGAAATCA
TTAGTTGCAAACATTGTGCAGTCAATTAAATTGTGCCAATGTTGTAAAAGTCATACTTGC
ATGCTATTTCAGATAGAATATTTAAAGTACAACATAGACATTAGGGCTGCATGATATTGG
ATAAAAAATTGATATTGCAATGTTTTTTCTCTTTGATTTTATATTGTGATTAGAAATCTT
AATATATTATATATTAAAATGAAATTATGAGTGCTTTATGCTTTTATGGAGAGGGTCTAA
CAGTATTCAGGTACAGAAATTGAATAATCAAATATAAAATAACATTGCATAGACTACATC
TTGTAATATATTCAATGAAATGAATGTTTATTAAACTTTATGCTCTATTCGAATGCTTCA
AACTCTCTTAAAATGCTCATAGTCGAGTCTTTAAACACTTTGCAGATGATAAACTTTACC
TCTATTACGGTTTGATTCTGCAGAGTCTTCGGAAAACTCATGCGTTTCAACCTGTGGTTT
CTGGTCAACTATAATCCCAACCTAATTGCGTATCTTGGAATGGGAAATTGCAAACATGCA
CATTTTTATGTAGATGCTCAATACGTTATGAAGCCCTAATAGGCATCGTGTCACTGTTCA
AAAATGAACGAATGTGCGAATATAAAACCAACTTTACCTTAATATTATTTTGTGGAGAGA
CCGTTACACTGATATTTTATTTGTCTTCTATATATCAGGGTAAAAATGTAATGTATAATA
AAATCATAATATAACAGAACCCTATGAAATTGAACCAAAAATTATTACACTTAGTTGTGA
TACTTTTAACCCCTTTTTTTGTATTTGCCCCATTCATCGAAATTGGATGTCAATTGTTTT
CTGCCCGTCATTAATTTCTGCTTGTTCACTCTGTAGGCATCATGGCGGCCCTCAGACCCC
TAACCAAACCTAAGATCGTCAAGAAAAGGACCAAGAAGTTCATTAGACATCAGTCTGACC
GCTATGTCAAGATCAGGGTAGGCATCTTCCAGGATTATATAAATTTCCATTTAAATGGGG
TTCATAGGAAACAATATATCTGTGTATTTTTGATTTTTGTTGGTTGTTACATTTGCTTAA
GTTGCATTATTACTTTTATAATTACTGTATTATGCACCGAGAACGTTTGGTCAGCGCATA
GGCCCTATTAGCATTGGTCCTTTAATATTATAAAAATAATTATTCTCTAGAATAAATCAC
ACTTTTTGAGGGTCTAAACATGCTCCAACTGCTGTTTTATAAGAAATATTTCTGTGTTAA
AAGTTCCAAGTGTATTGTACAGTCAACTTTTGTATAGTAATGTTAGTCATCATTTTAACA
CCAGGCATGCATTAAAAGGAAATTTTTTGCTTCCCATTTCAAAAACTAAAGGCTGATTTA
TACTTCTGCGTCAAACACTGGCATATGCTACGGCGCTGACGCATAGCCCTTCGCCGTGGC
CATCGCCGTCACTGACGTGCACCTCTCAAAAAATGTAACTACACGTCGCAACAACGCGTA
GCGCAAGCTCTGTGATTGGTCGGCTTGGTAGCGCTGACGAGTCTCGGCGGGACTGAGATC
CGCGCGAATGGCGCAAGCCCGATGTAGTGATTGTTTACAAGTGTGGAGTCCCGTGAAGGA
GCTCCGGATGGAAAGTTGTGTTTTGTGTTTACCTCATAGTTAAAGTTGTTGCACGTCCGC
CGGTTTCTGCCTCAAAATGAGCGAGTTTGAGTCACTTGTACAACCAGGAAGTGTTCAGGA
AACGCAAAACAGAAGCGAAGAAACTCGACATAGAGGAACATTTACACCTCACTGCCAACT
AGCATTTTGTAAGTGTTAATGCAGACCAACAGAGACAGCGCGCAGAAGTATAAATGCACA
GCTGCGCGCGTTGCATGCGCCGTGAGTTACGCCGGTCACTTGACGCAGAAGTATAAACCA
GGCTTAATGCAGAGCAACGTACCGTGATGTATAGAGGAATGAAAATATGGAATGAATTGC
CATCAGACATTACATGCTTTGTAACAAGTAAAATGAGGTTTAAAAAATCATTTAAAAAAT
ATTTAATGGAACAATATTAAGTGGATTGTTGATTTGGATGTTATGTATGAATTTTGTATT
TTAATGTTTTTATTAGTCTTTGTTGTTGTGTATTAATGTAATTTTGTGTTATGTTCGATG
GACCCCAGGAAGAATAGCCACTACCTTGGTAGTGGCTAATGGGGATCCAGATAAATAAAT
AAAAAAAATAAAAAACTCAGACTTTGCTCAAATGCCAGAAGTGAAGAACATTTACATTTT
ATGGGTTTCAGAAGTGGGTGTGGCAAAATGGCTCGACAGCGCCATGTATGCACATTTGAC
TGAGTTTTTTTATTAGCTTAAATTATTATTTGCGACAAATTATTTGTTCATTCAAGGGCA
ACGGGTGGCGGTAAGCCTGAGTGCAAAGTCCTTTCCATTGCTGATTTAATTATTAGAAGT
TGTACTTTTTAAATATGATGGGCATTTACTTTTCATAACTATTATGCAGTAGACCACAAC
AGTCTTTTTGATATTTACTATTTGCTGATGAATTTTAATAGTCAGACCTGTTCTGATCAC
TGAAGTTAATTAACAGCATTTTTGATTTGTTTTGATGAACCCATCTGTTTGCATTAATGT
AACTTAAAAAAAAAACTTAAATAGCTAAATTTATTGGGATCATTATAAATCAAATTGGCA
TTTAATGAATTTTTAGTCCTCTCCTCTCCCTTATTTAAATGGGTAGACAGCCAAAATGAA
AATTGCCATTTAATCACACTCCACTTGATCCAAACTTGTCCACAAAGCATCTTCTGAAAT
TGGAAACATGTAGCCATTTACAACCATAGTGGTGCATAAAATACTACTAAAGACATTGGT
TACGGGTTCCCAGTTGTTAAAAATGAGTCTAACATGTTTATAACAAGTAAAGGAAAAGTA
ATTGTTGACCATTTTATTTTTGGGTGAACTGTCACTTTAAATTTGATTGTTTTGTTCCTT
GGTATGATTTTCATATTACATTTTGCTTCAAATCAAGGATTGTAATGTTGAATTTGTCTT
ATCTGGTTGGGTTGGTTTATGACTTGCAAGAAAATAAATTTTTATCGCAAACCAAAATAA
GAAACTTAAATGAATAATCTCTCATCAGGCAAACTGGAGAAAACCCAGAGGTATTGACAA
CAGAGTGCGCAGACGCTTCAAGGGTCAGATGTTGATGCCCAACATTGGTTATGGAAGCAA
CAGGAAGACCAAACACATGCTGCCCTCTGGATTCAAGAAGTTCCTGGTCCACAATGTCAA
GGAACTCGAAGTCCTCATGATGAGCAACAAGTAAGAGCCAAAATAGTCAGTAGTAGAGAA
GTGAATGTGATTTGTGTTTGACTAACAGCTTTTAAATCTTTCAATTGGGTGCTTCTGATA
ACACATAACTGTGCTATTATCTCTGTGGTCGTACCTGCTGAATTCTCCATATTCATCCCA
GGTGTAGAATTCAGAGAAATAGCATTGCAGAGGAAGTGCCCATTCCACCGCTAACTCTGT
CCGTAGTCAGCTGGTGGAAGATAATCTGCTACAAGTGACTAGCGCTTGTATCCGGGTGTT
CCTCCTAGATCCTAAAGTTTGTGTAATGAAGATTCTTGGGTCTCCTTTTGCTTTTAAAGA
AGTTGTGTACTTGTTGTTATTTGATACTTGATCGGTATAAAAATGCATGCGAGACCTGTG
GTACGCAACACTTTAGTGTTGGGGTTATGATGATTTATTAGTCAGAAACTGAGAATGAGT
GATAACCTAAAACTTTTGTTTCTCTGCAGGAGTCATTGTGCAGAGATCGCTCACAACGTG
TCCTCAAAGAACAGAAAGCTCATCGTTGAACGGGCCGCACAGCTGGCAATCAAGGTCACA
AACCCCAACGCCAGACTCCGCAGCGAGGAGAACGAATAATCTGGATATCTTGTTGTCTTT
TCAATAAAGTGTAAAATGTTAAAAAAAAAAAAAAACAATTGTTCAAGTGTTCGGTCTCAT
TTTTCTGACCTCATCTAGGCTCAAATCAGATTTTTAACACATCCTTAAATGCAATAATTA
CGGTAAAACAGTAGTGAAGTGGTTAAGTACACATTGATTTAATTTTTGTGATATGATCAT
TTTAGCATGTTCAGCATAACTTTGTTTCTGTACTTTAATGTTTTTTCAGTGTCAAGAACT
TTTGTGAGGCATTTTTGTGTTCTTTGAACATTTTTAGCACTAATTTGCAAAAAAACTTAT
GCATCTACACCTATTGTTGAAATTGCTTTATGAAAGCCCAATTATTTTTTTATTATATAA
AAGTTAATGTTTCTGCAATTCAGTTTCGTTATTTTTTTTAAAAAATTTTTTTATTTTTTT
TAATGAATTGTAAATTAATTAGTTCACCCAACAATTAAAATTGTTATTTACCTTTATTTG
TTCAAAAACTATTTGATTTGTTTGACATATTTTGGAAAATGTCAAATATGGGCACTCATA
GAGCATAATTTATTTTCAAGTGGAAATTCAATTATTTTTTTTTTTCAAACAGTATTTTTT
ACTAAAGAACTTGTGCGGTCAGCAAGTAGCATTTTTGAAAGAAGTTATGTTTTTAATGTG
GATTAATACCACACAAAGGACCATAAATTAGGAGTTTTTTTGTGAACTAATCCTAAAGTG
TTCTAATAATTCCAAATTATTTAATATTGCTTGTTCTTTGTGTCCTTTCATTTATATATA
TATATATATATATATATATATATATATATATATATATATAAATTGAGCTCAAATATGAAA
ATAGTTAACAGATTTTGAAAACCACCTCGTCTAAAATGTTGTTTCTATAGAAAGAGGCTT
CAAGCTTTAAAAGCAGGTTGTCTGCAGGATCTTGAGCCCTTAATTTCAAAAACAAAATTT
TAGGCCTTAAAATATTAAATTCACTGAAATCCTGTATTGTAGGTCCTAAATCATTGTAAA
TAGGTTTTAATTTTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 2856..2956, 5128..5309, 5789..5977
2861..2956, 5128..5309, 5789..5918
NC_007133.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved