Danio_rerio Locus eef2a.2
snOPY snoRNA Orthological Gene Database
Danio_rerio eef2a.2
Danio_rerio
eef2a.2
22
SNORD37
8044..8100
12145
aacaaaacctatttagatttagtgaaataaaaatggtattttgtaacaaagacaataac
aatactacaggaggttttgtgcactgtcaaatgctttcttcacaaaatgactctttccat
ctacttttttaaatctatcgttggtctcaaactgaattcctggagggcggcagctctgca
cagttttgctccaaatcaaacacagcggatgcaactaatttaggtgtttaagacgctttt
gaacacttctattatttgtgtcagatgtgtttgatatggttggagcaaaactgcagagct
gtgcccctccaggaattcagtttgagacctatgatctacatcagaggtgctcaaccctgt
tcctgcagatttcagttgcaatcaacccatatcaaacacacctgcctgtaattgctgttc
aggtcctaattaattggttcaggtgtgttggatcagggttggagctaaaatctctaagat
agatgccactgatctgcattttttcaaatggatgcagacatttgctaaacgtgcagacga
acttgtgtgcacaaatgagtaggataaactttttatctgacaaggaaaaatgcaaattaa
cttcagcttgtgtgatggtcaaatataatttaatcaaaatatgtatattttacaataact
ggcagcaatggctgctaggaaattacctcaaatatgtgttagcaagatattaggttttgt
agatagaacatgacgtaagctgactaaaattagttttctacatcttgcactaagttgaca
accacaagtaaatattaacacgatgcgcaaggtaaatatcaaaggaatacaaaacataac
tggacagttccattctgtatcacaactacaagaaaaaggtaaacaagtgattgatactga
ctgtaaaataacttatagacataacagaaactacagaggcgtcaagattttaaggaagcg
aaataaaaaaataataaatgcatatattagtgatattataatgcattttctgtagatttc
tgtgtcaatgtgaattaattttaaaaattactaaaccaaagtgaagaatgacccgacgtc
attacgtacaaaacgtagaacgcgcgacataatcggcggttccgccctataatttacagt
ctttggttccgccctggtaggcggcgtgaaagtgcattcactgttgagtgaatgcaaaaa
cattagacaaaatggtaagtcgatttatgaaattatttattatatgcaatagttaaccta
cagttggcatgtagttgcgttttaagcaccaacattgactataatgagggtgacgtacat
gctatcagaagtgactcgtttgaattgctttcgtctatatacgttttttagacaaataat
gtttaaaagagtttggtcatttgattatttaatccagtattagcttattagcgtttagca
gctatcataagagaactttactgtttcctgttctggctgttttattgaaagtctgtcagc
tttatttattctcagctcggtgtttttagtgctttaatttttcatattcaacttttcaca
agtttttttttagaattcagaaatatttaaaaatccatattttcatagttaataatatag
taagtatagtaattacaagtaatctaaacgcattgtttattagaacagacatcattctta
ttaaaacgaggttaatgtgaaggtgtttgttatatatggatattacctattaataaagtc
ctaaaaaatggcaagatatgaacctctgattttgaatttagtagtacatccaggcttatc
gattggtagtcgatggtgttaagtagggtgtattgccttattatataggggtaagttaat
atatataatattatataataattcacacagaaataaaaattggcgtgatttacttgccct
cattgaggggaagttggttttatattcacacattcacacgttatccctattataatttca
gaaaagtattctttgcaaattctaagtgaaatcgtattagcagccagtgactaccaaagt
acaacattgttcccagttaaataatacaaatcatacttgcatgttatttcagaccgaata
ttcaaggcatcatggtaaacaatatagggagtgtgttacaaattgtcactaaaggaattt
gtgaatataaaaccaactttacatcaatcttactctgtcttgtgcttaacctgtttgagt
ttttgctatggatgtcaatggacatccgttttcaacattaatgaatgaacaaagctacct
tgttaaaaattgtcttttttttagcaataaatttaaggatagaaaaaggatactaagtag
catattttaaaactagaaatatgcctccttttaaatttctcctaattttacttctttagg
agaacttcaatgtagaccagatccgtgccaccatggacaagaagtccaacatccgtaaca
tgtctgtaataggagcttttgatcacggcaaatcaactttgacagattggctggtgtcaa
aagctggtatcgtcagctcagcctgtgctggagaaacccgattcatggatacgaggcgtg
atgaacaagagcgttgcatcaccatcaagtcaacgtgagtattaaggtcagactactaaa
tttttcacagattttgcctaattttcttggcaaagtgttgtggggattcgtaaatgacaa
actgccgtcgtgatgtgagattcaatcatttcttctcgtgtagtgtgtcatagtgtatga
caaccaatgccatgtctgcgacatttcacaacatcatcccttcaaggcttcagcccggtg
agtactagaattagcacgtaaactaacaaaccactccatgatgttcttggatagggctgg
gcgatatgacatctcctatcacaagatacaatctacatcactatagattcagtcagttaa
cataatacagaattgaaaagttatttgctagccatatacacttacgggccactttattag
gtatactttactagtacagtggtgaccaccttttgccttcagaactactttaatccttcg
tggcatagactcagcaaggtactggaaatattcctcagagattttggtctatgttgacat
gatagcatcacacagttgctgcagatttgtcggctgcacatccatgatgcgaatctcgcg
ttttaactcatgcttaaggtgctctgttggattgagatctggtgactgtgaaggccgttt
gagtgcagtgaactcattgtcatgttcaaaaaaaccgtctgagatgattcacgctttatg
acatggcttgttatcctgctggaagtagccatcagatgagtacagtggtcatagagggat
ggacatggtcagcaacaatactcaggtaggctgtggcgttgacacgatgctcaattggta
ctaatgggcccaaagtgtgccaagataatttgccctacaccattacaccaccaccaccag
cctaaactgttgatacaaggcaggatggagccatgctttcatgttgttgacggaagattc
tgaccctaccatctgaatcttgcagcagaaatcaagacaccttagaccaggcagcatttt
ttacaatcttctattgtccagttttcgtgagcctgtgtaaattgtagctagtttcctgtg
cttggctgacaggagtggcacctggtgtggttttctgctgctgtagcccatctgcctcaa
ggttggacgtgttgtgcgttcaaagatgctcttctgcagacctctgttgtaacgagttgt
ggcgaataaaatgttctcccattttctcaaagtgccactaggaggcgctgctctgttctg
ccctccctcgagcttccaaaacctttcttccggggtcgggaggaaacggaagatcaggta
cacaatagaagaccataaaagggggtgttgagggttgctccggggtgttgttgttgttgt
tgttattgttgttagagctggggtccgttcttcgtacctcgcttaaattatctaagatta
tttggcagatcccggatcttttaatcttgataactgatctctcgctaatttggttcttca
aacgagttcgcgaatcagattagaatgtctggataaactgatctgagatcgctgcgtgtg
ttgtgaaggacagatctatcgatcctcgaaatcatgatcagcaatgcaacgattggctga
cggcacagcagcgtaatgacatcatctgattaatattcaattatccatgtgagcaaaatt
acatcaaattagcagtaaacggcttgttaaatatgacacgcaataaccttccacatttgt
tgtgagctgcaggctttccacgttcatgtgtcaagtgtattcatcattcaatgcaaatca
atgtatttagttctacatttagaaaatattttctttattatagtagccgttttttaattg
gtgtaaagaataactggttgtttacaaaagcattttcatattggtaaaggtgtctgcaac
ttttgtgaagcatcaaatcaccggcatattaactatcaaaacatgtttatgactgcataa
atgtattattgcttttaaaaaagtcacatattgtgcatttctattatccacaatttgtac
taaagcgatctaaaaagttcatatcaataagttttctctttgcaccaggtggcagtcttt
gtactttcatttcgagggtgcagattgcatacgttttattaatatgtataactttattta
ttttattaatgactataattttatatatatagttttaaaaaattaccattttcccaagtg
tatataactactactgtaataaaatatcagaattcggaacatactttctgtattatcttt
gcttgaactaagccgatctaatcctgtttatatgacttgaacctgctcccgatcaggttt
gacctagcagaactgttgctatgacaacaactctcggattagctttgaagaacgaaacga
tcctggatcgtgtcaaatcgtcaatatccaaatccagctaactgagtaatccacgtacga
agaacatacccctgctgttgaagttgctgtcatctttgctgtttttttattcgtgggttg
gtggtgaaatcgtgggggagaaaagacgtgaaacaagaaagatacaaaggtgaagagctg
ttggctttgaagatggagatgtgacgataaatactgtggtgtgaaagtgatggtggatag
gctgaccagaaaactacacaagcgattaagtgcgaggggtctgcaggatcttatggggat
cgaaagcaaaggtggatctgtaccgaatcagcgttgtttgccgggtcagttatttaggtc
attcacatacattcatacacccatacaatccacacccattgcaactcaatttcacaaact
ttctttacatttctctttctctctggtttctgttacctcagccacacgttattattgttt
gtttgattgattgtttgtttgtttgatgttttctttcttttattttattgacttatttaa
cttaagcagtgataatttttttgttgttaaaaatcgtcaaccaagattgaacagtggtga
aaaaaactagttattatttagaaaatatatatttgttgtactgtgtgttaaaaatacaac
agttgatttcatttaaagtgtgttgcgttgttattatttatccttttgtttttcattgtg
tatggtggttgaatgccagccgtggctaaccagggtattagtaaatgtttttctttttgg
caaggtaatcttgtctggcgcccaaagtttaattaaaaatattgatacctaatatttttt
ttgtttgaggtccactgggagtgagattaagggccgtgaaactctgaaacttcctagtga
tcacttggacaagtggttgaacgatggactgtggtgcaggcggacctgtgttcgaatccc
accaaaattgtttttttgaaatttctttttatttttcttcattcaagttatatataaacc
taattattactaccaaccaccattacagagtggttctttgagttactattgcctttcttt
cagctcgaacaagtctggccattctcctctgacctctggcattaacaagtcatttgtgcc
cacagaactgccgctcactggatattttctctctttcggaccattctctgtaaaccctag
agatggttgtgcttgaaaatcccagtagatcagtcgtttctgaaatcaatttgcaaacat
attgaaaaatgggcaagagcaaactataaactttagtgacaagtcatcacactcaaccat
ttactgtactgtactgcactgagccctaattgccataaacaatgtattttgcaaaaccat
gaaaaacaatacagcgaaaaatgaaactgttttgttttatattatgaacaatatttcatc
catacaataaatcgtcatatcgcacagccctgttttctgttttagaattagcatgtaaat
tttaaccactcattatgttctcattctctttgcgatctaattaattttatatgaacgtat
ctttaaaggtaaccagctatctactaaaagtttccttgtccgtttgatttgaagtaacat
tagcgtttgtgagcatatcgctgatttatttacagccatcactgggaatctacttctgca
gctctttctgccacagaatgcatctactcatctacagttttgttcagaaagctatgtatt
aggtaaattgctgtctgtcggaaacacttgaacgcacagtataaacgtcatgtgacgatt
gactgcaaaccaacttgtagtctggcatgtttgttacccacaacacatcaagattttatc
tagacaagtttgcttaaactgacagagtcatgataaaaatgatgtagtctgaatgggtct
caaggcatattgtatattgcaagactgaaatataaaccttaagtctacaaacattttaat
aaatatactttcaccgtttgcccacacagtgctatctccatattctatgagcttgctgat
aaggatttggctttcattaaagagtgcaaagatggctccggcttcctcctcaacctgatt
gactcccctgggcatgttgacttctcttcagaagttacagctgcactgcgtatcacagat
ggagcattgctggtggtggattgtgtgtctggtatgtgcagaaatagcagttttgatttt
taaatcactgttttattaatcaaagacttccttggtataattttgatagtcatgcctaat
atatgaattctgtaacttgaacttgagctctcttggaggcttattaaaatgtcaaattgc
tgtttagcaggtgtgtgcttacagacagagactgtgctcagacaggccattggtgagagg
attaaaccagttttgatgattaacaaaatggatcgagctttgctcgagctacagttggtc
cctgaagagctgtaccagatctttcagcgcattgttgagaaagtcaacgtgaccatctcc
acctatgctgaggatgagaaaggccctatgggcaacgtcatggtgagtgcctcaaggctc
cgtcatgggtcctttaatgctttctgttttatctgtgggcttatttctaatattcattgt
gaatgtttttaacatcctgatcttagattgatcctgtcgttggtaatcttgcctttggat
ctggactgcatggatgggccttcactttgaagcagtttgcagagctctatgtgaaaaagt
tcgctggtaaagctcagctgagacctgaagagtacatcaagaaggtggaggacatgatga
agaaactttggggcaacaggtgagaggatgttccaacacaactgaatgaatgtaatcttg
catttctgtacgtgacattttatgtccatttgtttgcagctactttgactctactactgg
caagttcagtgagtctgcgacatccccaaatggcaagaagcttcccaggacttttgttca
actagtcctggaccccatcttcaaagtgagaaaactagcaacaattctgtttttaatgca
agccattgatgatgatttaaacattcttcactttgacctgaatatctatattacatagag
atcttattcttcgccactataaaggtatttgatgccatcatgaacttcaaaaaggaagaa
actgcaaagctgattgagaagatgggcatcaagctagatgcagaggaggagaagatggag
ggcaaactcctactgaaggctgtgatgcgccgctggctgcaggctggagaggctctgctt
cagatgatcaccatccacctgccctcaccggttactgcccagatttaccgctgtgagctg
ctgtatgaaggacctggagatgatgaggctgccatgggtatgtttttgctttttgagtat
aaaaactgtagcaaggaaatcctcatgttctgtaactatatcgagtttgtgcttgtagtt
aaagcctgaatgttttgtttgttttctcaggcatcaagaattgtgaccctaaagcacctc
tcatgatgtacatttctaaaatggtaccaacatctgacaaaggttgtttttatgcgtttg
gtcgcgtcttctctggctgtgtctccactggcctgaatgtgcgcattatggggcccaact
tcacccctggaaaaaaggatgatctttacctgaaacccatccaaaggtaagttattttga
tttgtatttccatgaaacttttaggtatggtgaataaccatttatttgtgaattgcctac
atgtttttgtgtttttcaggaccgttctaatgatgggtcgctacgttgaacccattgaag
atgtgccctgcggcaatattgtaggtctgttaggggtggatctgtttttggtaaagactg
gaaccatcactactttcacaaaagcctacaatatgcgtgtgatgaagtttagtgtcagtc
ctgtggtgagagtgtccgtggaggtcatggaccctgctgaccttcctaaactggtggagg
gattgaagcatctggccaagtcagatcccatgttgcaatgcatcttcgaggattctggtg
agcatatcattgctggagctggtgagcttcacttggagatttgccttaaggatcttgaag
aggtccatggtctcaaggtaccaatagctagtctaattgtgcaccacattataccaacta
tgattgttctctaacatgctgttctttacagaaatccgatctatttgctacctacagaga
gacagtcagtgatggctccaaaaaaatgtgccttgccaagaccccaaaccagcaaagtcg
tctcttctttaaagcctgtcctctggctgatggtcttgcagaagatattgataagggtcg
ggtcactgccagccaggagatgaatgcccgtgcccaataccttgctgaaaactataagtg
ggaagtgactgaagctcgtaagatctggtgctttggccctgagggaactggacccaacat
cttggtagatttgaccaagagagtgcaatacttaaatgagattaaggacagtgtgattgc
tggatttcagtgggtcactagagaggtatgataaaagcataacatttattaatgtcacta
ctcctcgtactcaatccattcagctaatttctggatctggcagaagaaaaccttggcata
aatcaatgaatcaaattaaacctttaacactatgggagttgtaaaataaacttccaaagg
tggagtgttctttaagctagagtgtcctctggattctcttgggtaaaggccaccttgata
gatttgatagacctttctggaattttctaaattgcaaagattgatttggcttatgttcaa
ttctgattggattaagatgtccctctattatcaactagacacatttgctttagtttgagt
cacagctctctaaagtgttttgtgcattccagggaatcttgtgcgcagagaacatgcgtg
gcattcgcttcgacattcatgatgcaactttgacttctactgccattcaccgtggtccag
gtcaagtgattactgcaacccgccgagtgctttatggctgtcagctcacagctgaaccaa
ggcttagtgagccggtatacctggtggagatgcaggtataaaagtagcattaaaactcct
gctcattgatcttttggtatttgatgccaatctctaattgtaccacacttttgatctgcc
tacagtgcccagagtcagttattggtattattcatgctgtactggtcaagaggcgtggag
tagtgtttttagagtcccaggttacgggaactcctatttatttgctcaaggcttacttgc
ctgtcagtgagtcatttggtgagtgaagctgaaaaaaatcttggcttgtcttctccggtt
aatgattcaagttacatagtgtaaatggtatctccttttctttgcaggttttacagctga
cctttgtgccaacacatctggccaagccttctcacagtgtgtgtttgatcattggcagat
catgcctggagacccattgaatactacctccaaaactgctcatattatggctgacatacg
aaagcgcaagggcttgccagaagccaatctagctttacatcgcttcttggacaaatttta
ggtttactgcacagactttaaatcttgtattcaagaacttgaaccttttttaagtcagac
caccctataattcccacaaaaaacaacactttttagagaataaacagttaattttcaaat
ggttcagatgtgttaaaccaggggtggccaatcctgttcttggagagctaccttcctgca
gatttcagttgctacccatatcaaacacacctgaaccaattaattaggatctaaacacca
tgtgataattataggcaggtgtgtttaatatgggttgtaactgaaatctgcaggaaggtg
gctctccaggaacaggattggacacccctgtgttaaacagttcaacacatcattcctaat
aatgaactggtaggttctctgaaaatgaccaagtttaattcctctgtctgatctcaaacc
tataattttattggctcatgtatgaaaaatggcaagagatcaacctgagcattaatgaaa
agcactttccaaattaaattttcagaccaggcatgaccaaactgtactttccctgaccaa
atcttgtcgcttatctattttgtagaaacacttgcaatgaacctgacgtttaattaagca
aattgtgttagaaatagctcatatgaaaagctaaaccccccctaaatgatgtttaatgca
ctgaaatgaattagttttcatgaagtttttttgttgcctatagagaaattttacaaattt
actgcaaatacaaaaacatgtcagcaaattagagtagtggtgctgcgagacccaaattta
atgtcttgtatgatatccatgtgcttgaaggactgcatccatgcagtttggcaaggattc
atacaatttattgatcaagtcagcacctgataataaaacactgtgatttctgcttcttat
gcgtttctaaaataagaaaagagaagatatatgagctaaaggcggacaagcgcaaataca
aatacgacgcatcacctggttctaggcctaatgccaccttgtctttgagttccaccatca
cctgtttgtgagtgaccttatcccctccggtcagcccagagaaaatggattcgatggacc
tgagatcgaagattcttcactcgctcaaggtctgagctgaaaaatgctcttgctgatgac
ttcaactcccttaaaaatgaaatacaagcagtcaaaactaaaataataaacagcacaacg
gcgatacactctgagaaagaccaaatgaagaatacaatcgaggaaacggaaggtgggcta
tcaacacagtcagacaaagtgacaactttgcaaacagtggtaacagatttaaaagcagag
atgatcatgctgagaaagaaatgtaaagacatggagggaagaatttgaagatgcaacatt
aggatactaggtgtagctgagacagggatgaagttctgtaatgtcggtgtcaaggccaag
agaatcactacagctggaaaaagatgtacttgtgcagcgttcacatagatgtcttgcacc
gagatatttggacagttagctacagg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1213, 2399..2613, 6989..7170, 7327..7541, 7646..7818, 7899..8004, 8124..8376, 8490..8685, 8779..9136, 9211..9564, 9932..10114, 10205..10337, 10427..10738
1211..1213, 2399..2613, 6989..7170, 7327..7541, 7646..7818, 7899..8004, 8124..8376, 8490..8685, 8779..9136, 9211..9564, 9932..10114, 10205..10337, 10427..10620
NC_007133.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved