Danio_rerio Locus Poly:snord3
snOPY snoRNA Orthological Gene Database
Danio_rerio Poly:snord3
Danio_rerio
Poly:snord3
20
U3, U3, U3, U3, U3, U3, U3, U3, U3, U3, U3, U3, U3
1001..1216, 1968..2183, 2933..3147, 4088..4303, 5068..5283, 6032..6246, 7190..7405, 8154..8369, 9134..9349, 10098..10313, 11061..11276, 11977..12192, 12939..13154
14154
tgggccggatctgggtcagaataaaagcaaactgtggcccagaatagggtcagttctgg
ttcatttggttgaattctggctgatacgtgccattgctatggcttaattgtggcccagat
ctggcaaacaggagtggactgcccaaatgccatcattccatgcggtatgtgggccggatg
taagtgtctggtgtggaccgtatttgagccacatgaattttgctagctttagtctgattg
atgaatcatgaaatagttaatgcatgaccatctgtgtttcaagagttcacacttagatac
tgtttaacaacttgttagcaagttagcaggtttggcatgctgtccagggagagaaccctg
agctcggagataattgatcccagggctcccgccaggtccatagagcatgtgaggggagta
cgagatcaggtgttctcgagagctcccctcggcaaaagaggaaaggaggagaaggggtgg
atggggggtttcttcgggaaaacgaagataagggagtagttattagctacgttactttta
gtgagtttagatgaatctgactggctggctaatgagtgtagatgagtggccagctgcagt
caatcatatcacgtgctcctcttgaaattagtttgtgaagcttcatttaatcgtaagcaa
gcgatcctatcgaaattactttataaattgatttcagaagctgaacttccaccgtgacat
ttatactaaacgaagcagtttcaacttaactagatcttacaccagcattctgccacttct
cttattcctgcctgaattgttggaatgttccccaatttgaaatattacggcttttactct
gttttcatcatctgtgttcagctgttttgacagcttacgttgtaaaagcactgtggaaat
aaagatgaattgaatcaaacttctcatggctttgtgagcgtctccgtaagtgagacagcg
agtgacagaagagactccagctgcttttgagcctgaagattaagactatactttcaggga
tcatttctatagtttctcactaggaaatgtgtttcgaaagtgttgtgtttcccaaaccgc
gatgaagagtgttgatgctctgttctatgcgtaaatctggtgtagagaaatggtttgtct
catatgctctacactgttgatgaccgctcctgactgattaaagcagttttggaggaaaag
agtatgaactgagcggcagttagacttgatgaacaaatacagttgtgaaagattggtttt
acgaagttataacatctttggaatgttaatcaaaatttagaattaagtgtttttttttat
ctttatttgttttgttttttcataactgctgtcctgcccaattttattgtcagaacagaa
atgcctgtggtctgctaaacctagattccctcaaggctttttctttatttccagtagttg
gtagagttcaggtttcttgaaattttagactggatctagtggtctgaatctattgtggca
tgtaacgtgtgggtctgcagttggatgttatttggtcccttgctactgttgccgcctctg
gcttgcttggttggcgctgctggagctgtacaacgttggagtttctcttcagtggatcgg
cctttaacagtgacatttgcattgcgctgatctgaaataagctgaactgaacttccaccg
tgacatttatactaaacgaagaagtttcaacttaactagatcttacaccagcattctgcc
acttctcttattcctgcctgaattgttggaatgttccccaatttgaaatattacggcttt
tactctgttttcatcatctgtgttcagctgttttgactgcttacgttgtaaaagcactgt
ggaaataaagatgaattgaatcaaacttctcatggctttgtgagcgtctccgtaagtgag
acagcgagtgacagaagagactccagctgcgtttgcagcctgaagattaagactatactt
tcagggatcatttctatagtttctcactaggaaatgtgttttgaaagtgttgagtctccc
aaaccgcgatgaagagtgttgatgctcttttctaagcatgaatctggtgtagagaattgg
tttgtctcatctgctttacactgttgatgactgctcctgactgtttaacacagttttgga
ggaaaagagcatgaactgagcggcagttaaacttggtgaacaatatcagttatgaaagat
tgatcttactttttcttagcagtttaaggatgttgatcagttttgagaatgacgtttttg
ttttgtagcatttattgtctttaaactgatgctctgcccaagatgattagtcagaggaga
actgtctgtggcccgctgagcttggattctctcaagattttttctttttttctggtgatt
ggcagagttctggtttcttgaaatatatccagcctggatctagtggtctgaatctactgt
ggactgtaacgtgtggctctgcagttggatgttatttggtcccttgctactgttgccgcc
tcttgcttgcttggttggcgctgctggagctgtgcaacgttggagtttctcttcggtgga
tcactcttcaacagtgacatttgcattacgctgatgtgaaataagctgaactggacttcc
accgtgacatttatactaaacgaagcagtttcaacttaactagatcttacaccagcattc
tgccacttctcttattcctgcctgaattgttggaatgttccccaatttgaaatattacgg
cttttactctgttttcatcatctgtgttcagctgttttgactgcttacgttgtaaaaagc
actgtggaaataaagatgaattgaatcaaacttctcatggctttgtgagcgtctccgtaa
gtgagacagcgagtgacagaagagactccagctgcttttgcagcctgaagattaagacta
tactttcagggatcatttctatagtttctcactaggaaatgtgtttcgaaagtgttgtgt
ctcccagactgcgatgaagagtgttgatgctcttttctaagcgtgaatctggtgtagaga
aatgattgtctcattcgctctacaatattgatgaccgttcctgactgctcgaagcagttt
tggaggaaaagatcatgaactgagcagcagttaaacttgatgaacaacagtaattgttct
tatgatttcttagcatttttagtgtgttggttagacttccaaattacaatacttgttttt
aattttttatctctttgtctttaaactttggcttcgccaaagatctttagtcagaggaga
actgtctgtggccccctgagcctggattttctcaaggtttttttatttctgataattggc
agagttctgatctcttgaaatatatccagcctggatctagtggtctgaatctataagagg
gtctggctgcagacctggtgcagtgcaatctgggctgcttctaatgggctcacctaaccc
catccctaaccctacccgtcacagtgacgtcactagctccatttaaatgcattgtgtctg
acattgcattgctgagtgatgcagtctcagcttgcatcataaaggctgcatccagatact
atttgaatctactgtggcctgtaacgtgtgggtctgcagttggatgttatttggtccctt
gctactgttgccgcctctggcttgcttggttggcgctgctggagctgtacaacgttggag
tttctcttcggtggatcgaccttcaacagtgacatttgcattgtgctgatctgaaataag
ctgaactggacttccaccgtgacatttatactaaatgaagcagtttcaacttaactagat
cttacaccagcattctgccacttctcttattcctgcctgaattgttggaatgttccccaa
tttgaaatattacggcttttactctgttttcatcatctgtgttcagctgttttgacagct
tacgttgtaaaaagcactgtggaaataaagatgaattgaatcaaacttctcatggctttg
tgagcgtctccgtaagtgagacagcgagtgacagaagagactccagctgcttttgcagcc
tgaagattaagactatactttcagggatcatttctatagtttctcactaggaaatgtgtt
ttgaaagtgttgtgtctcacaaaccgtgatgaaaagtgttgatgctcttttctaagcgtg
aatctggtgtagagaaatgatttgtctcatacgctatacactgttgatgactgctcctga
ctgcttaaagcagttttggaggaaaagagcctgaactgagcggcaaataaacttggtgaa
caacagaagttatgaaaaattgacattgtgatttctttcaactttagaattgtgtttaat
cttcagaattacaattttcttttgttttattttaaattgtcttttttgtttctttaaact
gctgctccacccaagatgtttaatcagagaggaactgtctgtggtctgctgaatctggat
tctctcaagggttttacttcatttctggtaattggcagagttccggttccttgaaattta
ttttcagcctggatctagtagtctgagactaatgcggcctgtaacatgtgggtctgcagt
tggatgttatttggtcccttgctactgttgccgcctctggcttgcttggttggcgctgct
ggagctgtgcaacgttggtgtttctcttcggtggatcggccttcaatagtgacatttgca
ttgcgctgatctgaaataacctgaactgaacttccaccgtgacatttatactaaatgaag
cagtttcaacttaactagatcttacaccagcattctgccacttctcttattcctgcctga
attgttggaatgttccccaatttgaactattacggcttttactctgttttcatcatctgt
gttcagctgttttgactgcttacgttgtaaaaagcactgtggaaataaagatgaattgaa
tcaaacttctcatggctttgtgagcgtctccgtaagtgagacagcgagtgacagaagaga
ctccagctgcttttgcagcctgaagattaagactatactttcagggatcatttctatagt
ttctcactaggaaatgtgtttcgaaagtgttgtggctcccaaaccgtgatgaagagtatt
gatgctcttttctaagcgtgaatctggtgtagagaaatggtttgtctcatatgctctaca
ctgttgatgactgctcctgactgtttaacacagttttggaggaaaagagcatgaactgag
cggcagttaaacttggtgaacaatagcaattatgaaagattgatcttactttttcttagc
tgtttaaggatggtgatcagttttgagaatttcgcttttgttttgtagcattttttgtct
ttaaacttttgctctgcccaagatgcttagtcaataaagaactgactgtggcccactgag
cttgtcttctctcaagattttttctttttttctggtaattggcagagttctggttcctcg
aaatatatccagccaggatctagtggtctgaatctattgtggcatgtaacgtgtggctct
gcagttggatgttatttggtcccttgctactgttgccgcctctggcttgcttggttggcg
ctgctggagctgtgcaacgttggagtttctcttcagtggatcggccttcaacagtgacat
ttgcatagcgctgatctaaaataagctgaactgaacttccaccgtgacatttatactaaa
tgaagcagtttcaacttaactagatcttacaccagcattctgccacttctcttattcctg
cctgaattgttggaatgttccccaatttgaactattacggcttttactctgttttcatca
tctgtgttcagctgttttgactgcttacgttgtaaaagcactgtggaaataaagatgaat
tgaatcaaacttctcatggctttgtgagcgtctccgtaagtgagacagcgagtgacagaa
gagactccagctgcttttgcagcctgaagattaagactatactttcagggatcatttcta
tagtttctcactaggaaatgtgttttgaaagtgttgagtctcccaaaccgcgatgaagag
tgttgatgctcttttctaaacgtgaatttggtgtagagaaatgattgtcttattcgctct
acaatattgatgactgttcctgactgctcgaagcagttttggaggaaaagatcatgaact
gagcagcagttaaacttgatgaacaacagtaattgttcttatgatttcttagcattttta
gtgtgttggttagacttccaaattacaatactcgtttgaaattttttatctctttgtctt
taaactttggcttcgccaaagatctttagtcagaggggaactgtctgtggccccctgagc
ctggattttctcaaggttttttcttcatttctgataattggcagagttctgatctcttga
aatatatccagcctggatctagtggtctgaatctataagagggtctggctgcagacctgg
tgcagtgcaatctgggctgcttctaatgggctcacctaaccccttccctaaccctacccg
tcacagtgacgtcactagctccatttaaatgcattgtgtctgacattgcattgctgagtg
atgcagtctcagcttgcatcataaaggctgcatccagatactatttgaatctactgtggc
ctgtaacgtgtgggtctgcagttggatgttatttggtcccttgctactgttgccgcctct
ggcttgcttggttggcgctgctggagctgtgcaacgttggagtttctcttcggtggatcg
accttcaacagtgacatttgcattgtgctgatctgaaataagctgaactgaacttccacc
gtgacatttatactaaacgaagcagtttcaacttaactagatcttacaccagcattctgc
cacttctcttattcctgcctgaattgttggaatgttccccaatttgaaatattacggctt
ttactctgttttcatcatctgtgttcagctgttttgacagcttacgttgtaaaaagcact
gtggaaataaagatgaattgaatcaaacttctcatggctttgtgagcgtctccgtaagtg
agacagcgagtgacagaagagactccagctgcttttgcagcctgaagattaagactatac
tttcagggatcatttctatagtttctcactaggaaatgtgttttgaaagtgttgagtctc
ccaaaccgcgatgaagagtattgatgctcttttctaagcatgaatctggtgtaaagaatt
gttttgtctcatctgctttacactgttgatgactgctcctgactgtttaacacagttttg
gaggaaaagagcatgagctgagcggcagttaaacttggtgaacaatatcagttatgaaag
attgatcttactttttcttagcagtttaaggatgttgatcagttttgagaatgacgtttt
tgttttgtagcatttattgtctttaaactgatgctctgcccaagatgattagtcagagga
gaactgtctgtggcccgctgagcttggattctctcaagattttttctttttttctggtaa
atagcagagttctggtttcttgaaatatatccagccaggatctagtggtctgaatctact
gtggactgtaacgtgtggctctgcagttggatgttatttggtcccttgctactgttgccg
cctctggcttgcttggttggcgctgctggagctgtgcaacgttggagtttctcttcggtg
gatcactcttcaacagtgacatttgcattacgctgatgtgaaataagctgaactggactt
ccaccgtgacatttatactaaatgaagcagtttcaacttaactagatcttactccagcat
tctgccacttctcttattcctgcctgaattgttggaatgttccccaatttgaaatattac
ggcttttactctgttttcatcatctgtgttcagctgttttgacagcttacgttgtaaaaa
gcactgtggaaataaagatgaattgaatcaaacttctcatggctttgtgagcgtctccgt
aagtgagacagcgagtgacagaagagactccagctgcttttgagcttgaagattaagact
atactttcagggatcatttctatagtttctcactaggaaatgtgttttgaaagtgttgtg
tctcacaaaccgtgatgaagagtgttgatgctcttttctaagcgtgaatctggtgtagag
aaatgatttgtctcatacgctatacactgttgatgactgctcctgactgcttaaagcagt
tttggaggaaaagagcctgaactgagcggcaaataaacttggtgaacaacagaagttatg
aaaaattgacattgtgatttctttcaactttagaattgtgtttaatcttcagaattacaa
ttttcttttgttttattttaaattgtcttttttgtttctttaaactgctgctccacccaa
gatgtttaatcagagaggaactgtctgtggtctgctgaatctggattctctcaagggttt
tacttcatttctggtaattggcagagttccggttccttgaaatttattttcagcctggat
ctagtagtctgagactaatgcggcctgtaacatgtgggtctgcagttggatgttatttgg
tcccttgctactgttgccgcctctggcttgcttggttggcgctgctggagctgtgcaacg
ttggtgtttctcttcggtggatcggccttcaatagtgacatttgcattgcgctgatctga
aataacctgaactgaacttccaccgtgacatttatactaaatgaagcagtttcaacttaa
ctagatcttacaccagcattctgccacttctcttattcctgcctgaattgttggaatgtt
ccccaatttgaactattacggcttttactctgttttcatcatctgtgttcagctgttttg
actgcttacgttgtaaaaagcactgtggaaataaagatgaattgaatcaaacttctcatg
gctttgtgagcgtctccgtaagtgagacagcgagtgacagaagagactccagctgctttt
gcagcctgaagattaagactatactttcagggatcatttctatagtttctcactaggaaa
tgtgtttcgaaagtgttgtggctcccaaaccgtgatgaagagtattgatgctcttttcta
agcgtgaatctggtgtagagacatggtttgtctcatatgctctacactgttgatgactgc
tcctgactgtttaacacagttttggaggaaaagagcatgaactgagcggcagttaaactt
ggtgaacaatagcaattatgaaagattgatcttactttttcttagctgtttaaggatggt
gatcagttttgagaatttcgcttttgttttgtagcattttttgtctttaaacttttgctc
tgcccaagatgcttagtcaataaagaactgactgtggcccactgagcttgtcttctctca
agattttttctttttttctggcaattggcagagttctggttcctcgaaatatatccagcc
aggatctagtggtctgaatctattgtggcatataacgtgtggctctgcagttggatgtta
tttggtcccttgctactgttgctgcctctggcttgcttggttggcgctgctggagctgtg
caacgttggagtttctcttcagtggatcggccttcaacagtgacatttgcatagcgctga
tctaaaataagctgaactgaacttccaccgtgacatttatactaaacgaagcagtttcaa
cttaactagatcttacaccagcattctgccacttctcttattcctgcctgaattgttgga
atgttccccaatttgaaatattacggcttttactctgttttcatcatctgtgttcagctg
ttttgactgcttacgttgtaaaagcactgtggaaataaagatgaattgaatcaaacttct
catggctttgtgagcgtctccgtaagtgagacagcgagtgacagaagagactccagctgc
ttttgcagcctgaagattaagactatactttcagggatcatttctatagtttctcactag
gaaatgtgttttgaaagtgttgagtctcccgaactgcgatgaagagtgttgatgctcttt
tctaagcgtgaatctggtgtagagaaatggtttgtcttatacgctctacactgttgatga
ccgttcctgactgctcaaagcagttttggaggaaaagagcatgaactgagcagcagttat
acttggtgaacaacagcaattatgaaagattgactttatgatttttttactgtctttaga
atgttgatcaatcttcagaaatacatttttgtttggttttgtctttgtcttgttttcttt
taaactgatgctccgcccaagatgttcaattagaggagaactgtctgtggcccactgaat
ctggattctctcaagtttttttcttcatttctggtatttggcagagttctggttccttga
aaatgatttttagcctggatctagtggtctgaatctactgttgcctgtaacgtgtggctc
tgcagttggatgttatttggtcccttgctactgttgccgcctctggcttgcttggttggc
gctgctggagctgtgcaacgttggagtttctctttggtggatcggccttcaacagtgaca
tttgcattgcgctgaactgaacttccactgttacatttattttaaactaagcagtttcaa
cttaactagatcttactccagcattctgccacttctcttattcctgcctgaattgttgga
atgttccccaatttgaaatattacggcttttactctgttttcatcatctgtgttcagctg
ttttgacacagcttacgttgttaaaagcactgtggaaataaagatgaattgaatcaaact
tctcatggctttgtgagcgtctccgtaagtgagacagcgagtgacagaagagactccagc
tgcttttgcagcctgaagattaagattatactttcagggatcatttctatagtttctcac
taggaaatgtgttttgaaagtgttgtgtctcccaaaccgcgatgaagagtgttgatggtc
ttttctaagcatgaatctggtgtagagaaatggtttgtctcatatgctctacactgttga
tgactgctcctgactgcttaaagcagatttggaggaaaagagcctgaactgagcggcaat
tagacttggagaacaaattcagttatgaaagattgaccttatgatgtctttgtgtcttta
gaattttgttttgttttatctttgtcttttaattattttctttaaactgctgctccgccc
aagatgttaagttagagaagaactgtctgtggcccgctgagtctggattttttaaaggtt
tttacttcatttctggtatatggcagagttctggttccttgaaatttattttcagcctgg
atctagtggtctgaatctactgtggtctgtaacgtgtgggtctgcagttggatgttattt
ggtctcttactactgttgccgcctctggcttgcttggttggctctgttgaagctgtgcaa
cgttgaagtttctcttcagtggatcggccttcaatagtgacatttgcattgcgctgagct
gaacttccaccgtgacatttatactaaacgaagcagtttcaacttaactagatcttacac
cagcattctgccacttctcttattcctgcctgaattgttggaattttccccaatttgaaa
tattacggcttttactctgttttgactgcttacgttgttaaaagcactgtggaaataaag
atgaattgaatcaaacttctcatggctttgtgagcgtctccgtaagtgagacagcgagtg
acagaagagactccagctgcttttgagcctgaagattaagactatactttcagggatcat
ttctatagtttcttactaggaaatgtgttttgaaagtgttgtgtctcccaaaccaccatg
aagagtgttgatgctcttttctaagcgtgaatctggtgtagagaaatagttcgtctcatg
tgctctacactgttgatgactgctcctgactgtttaacacagttttggaggaaaagagcc
tgaactgagtggtagtcagacttggtgaacaccatcagttatgaaagattgatcttactt
tttgttagcggtttaaggatgttgatcagttttgagaattacgttttagttttgtagtta
ttttgtctttaaactgatgctctgcccaagatgcttagtcagtaaagaactgtctgtggc
ccactgagcctggattctctcaagattttttctttttttctggtaattgacagagttctg
gttcctcgaaatatatccagcctggatctagtggtctgaatctattgtggtctgtaacgt
gtgggtctgtagttggatgttatttggtcccttgctactgttgccgcctctggcttgctt
ggttggcgctgctggagctgtgcaacgttggagtttctcttcagtggatcgaccttcaac
agtgacatttgcattgcgctgatctgaaattagctgaactgaacttccaccgtgacattt
atactaaacgaagcagtttcaacttaactagatcttactccagcattctgccacttctct
tattcctgcctgaattgttggaatgttccccaatttgaaatattacggcttttactctgt
tttcatcatctgtgttcagctgttttgactgcttacgttgtaaaagcactgtggaaataa
agatgaattgaatcaaacttctcatggctttgtgagcgtctccgtaagtgagacagcgag
tgacagaagagactccagctgcttttgagcctgaagattaagactatactttcagggatc
atttctataggttctcactaggaaatgtgttttgaaagtgttgtgtctcccaaaccgcga
tgaagagtgttgatgctcttttctaagcgtgaatctggtgtagagaaatggtttgtctca
tatgctctacactgttgatgaccgtccctgactgcttaaagcagttttggaggaaaagag
cctgaactgagcggcagttaaacttggtgaacaacagcagttatgaaagagtgagcctgt
gaattcttaatgttattttatgttggtcaatcatcagagttccagttctgtatttttatt
tgtttttttttttttcttttttttgtttgtaaaccgcacttctgcttaagatgtttagtg
accccctgagcctgcatctttcaaggttttttcttcatttctggtaattggcagagttct
gtttccttgaaatattattcttgtgattttttggcatatttagtctgttaatcaactttc
agggttacaattttgtgtttttaattttcttttctttgtctctgagcagtttgtgtgtga
tgggtagcataatattacaggagaattgtaatccatgagttgtgtcattatgataaatgt
gctaaaagtgttttttaagttagtcataatgcaaacaagtagcatacaagtaacaataaa
aggcctttgtttatcaagaaaatccctgcacaatatatacacctggcttctttccgagag
tttcttattgagaatgaacaaaggtttaggtgtttaatttagtttggtgtcactaatgga
ggacagtgactgctgtttgtgatgtttgtgagttttttaaattttgttaatcatcaccgt
tgttgaggttcatacgctcattattaatgtctctgtgagcagaagttaaccataaacttg
tgttgtttataaacctttataattttgtgacatgtgcaagcatgttattatgttacttct
gacaatggattaaacattggttaacatctgtgaattatattagtttatcacagtttgtgc
ctcacttcaaaacaattagcatcacctgactttttatttatttaagttttatttggcttg
tttgctgtaacaaataaacttttcaaacaaagttcttatactgtaagtcaggggtggcca
atcctgctccaggagatctaccttcctgcagatttcagttgcaaaccttatcaaa
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007131.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved