Danio_rerio Locus LOC100536039
snOPY snoRNA Orthological Gene Database
Danio_rerio LOC100536039
Danio_rerio
LOC100536039
20
SNORA26, SNORA26
2099..2220, 2508..2629
3944
CTAGTTATGATAGCTGCATTTACTTGAGAAGTGATCCAAGCATGCATCAGCTCATAAAT
GAGGTCATGCACCTGATTTTGAGGAAAGCCATTCAACCATCATCATTACGTAAGAGCTAG
CCAGCATGCTATCCAAACACTTCTACTTACCATATTACAAATGGAGGCGATGTTTCTGAC
AGTCATTTAGTTTATAAGGTGCCTCTCGTTGCCATCTTTATGAAATAAACATGATTGTAA
CAGCGGAACACTGACAGGCCAAGCTGCAATCCCAACGGAGGACAGCAATCAGTGACCACT
CAATTCCCGCCGCTCATGCAAAGTGCAAACAAAGCGTGAGATAAACGTCGGCGGCTTTCA
TCTAGATGTTTTCTTCATGGCCACTGCAAATGAGAATAAAAATGCTGGATAAACTTATTG
TAAACATCTTTGCCAGTTGCACGTCCTAAACGAAACATTCACATCCTGGATTAGCGGTCA
AACCCCGCCCATTGAGTCCCGATTGGTGCGTTTGGGGAGTACGACACGAAACGCTGGTCA
GTTGATGGACAGGTCAACTGACCAATGAATGGTGAGAACATCAGTTGATAAATTCGCTGT
GGCCAGTAGAATTTGGATTTGATAGATAAAGGGGTTAAATCAAGTAACAACCATTTCCAC
TTACAAGCCCCTAAGAATGCACATATAATGCAGATATAAAGTAAATTTATTTTTACTTTT
CTGACAAAATGTATGACAATAGGTCTGTTTTCACAAAATATTGATCTTAATTTTTATCTA
GTTTAAACAACACTGCCTCGTGTGCTGTGCAGCCATGCAAAATAGCGTGTGTGATTCTAC
TGAGTCGATTCTTTTCTCAAAACCGGTCAGAACGTTTTGTTTGCTGATCAGTCTGAATCA
TCAGAGTGAATCAGATCAGATTGACTCCCCAAATCATCTGAAGAGGCGAAATGAATTTAG
AGGCGGTCCCCTTAAAAGTCCCAGAATTCCTCGCACCGGTCACACGTGTTCTTTCTTTTC
CGTTTGCACAATCCCTGAGAGCAGGCACAGAAAACATGAGCGGAGGCAAAATTACCTCTG
GTGAGATTAAATACTCAGATTAATGCACATATGTATTGTATTTTTTAATTAGTTAAATAG
ACTCTATGTTTTATTTTACTCCTGTATTTGCAACTTGGACTATAAATGTTTTAATTATTT
AACCTGAACAGTTATAGTGGGCTTTCTAGAAGTGTTTAAGGCTTGGTAAATATTTTTATA
ATAAATATCTTTTAAATAATGAAGCAATGCATTTATTAAGTCACGTTAAGGTTAGTATTA
AACACTAGTAACTTTTTAATTATTAAAAGGCCACGTGTTCTCTACACAGCACGTGGTGAG
TTAGCGGTCTACTTGCTAATGTTTAGCCTAATGTTAAACTTATTTTTACAGACTGGCCAT
CTGAGCCCCCTGACTGAAGAGGAAATCACCAATTACTACAATGTCTGAAATATAAAGGTA
AGGAAGTGTTTTTTTATATATAAATATATATATTTAATATCTAAAAGGAAGAGTTTTAGC
TCTGTGATGGTTCTAAGGTGTTTGTTCACCCTTGCACAAATCTAAAACAAAGCATGAAAT
CCACACATCTATAAAGTCAAAATTAATTACATTAAATGTTGCATGCTCTTCCCTGTTTGT
TCTTCAAAGCGAGTTTGTGTTTTAGTCAAGATTAAATATTGATTTTATCTTTTAAAGCCA
ATTTATTAGACGCTAAATATTTAGTTATGGTCTTTAGTTTTCCTATTTTTAAAAGAATTG
GCTCAAATTTTTGTAAATTAAATTTACAAATTGTATCTGTAGAGAACACGTTGTGATTTT
GTTTGTAAATGACTTTCATTCATTGTTTTCTTTTTAACCAGACAAATCCTGGCGTCAGTT
CTTGTTCAATGGAAAAAGCTTGCAAATAAAACCCAGAAATTAACATGATTGCTTTTTCCT
TGCTTAGGCTTAAAGATGGTCTTGTTCCAGAGCCCACAGTTGTTGATGAATCCTTCCACA
GTTACTTGGTGAGTGTGGTGCCTCTCAGCCCCTCAGCTCTGTTTTGTCAGCCCCTTTTAT
TGCACATTCAAGTCCTTCTATGGCTTGAGTGAATAACACAGGGGGGCAGAAGAATTCTCT
CAAAAACCTGAAGTGCTGGCTTTGATATTCCATGCTTCGGATCCTGTCGGGAGAAACAAC
TTTTCAACAATTATATTCATTACTTCTGTTTAAAAAGATCAATATTTAGTCTGTTTTCTT
TTGTTTGCAGGAGGTAAAGGCTAGGAAGAGAAATCTGCAATCATTCGGTGAGTAACTGTC
ATCCCATGATTCATTTATTTATTGCGTGAGCTAGTTTAACATTTTAGAACAAAAGGAGAC
AACAGATGATGCATAGAGCAGCACCTTAATCTGTTCAATGCATTTGGTTACATCTGTAAG
TTCAAAAATGTTCAGACTGTTAACAAGTCCAGTGTTCCCTTCTACGCTTTGCCCACTGGA
GGCTGTCTGTGTCTCTAGTGGCCATAACAGGGGGGTATATTGAGCTGCTCTTGTTAAAAC
CCAGGCCAGAGGTCATTCTCTGAGTCTGGATCCTGTCACAAGGCACATGTGAATATTAGA
TAGTTTGCCAAATGCAGTGCTTAATTTGGTAACTTGAATTTTAAGTTTTTTTTTTTTTTT
TTTTTTTTTCCCTCAACAGGTCACAATGGCTGCGTTTCTGGGCCTTGTGTTCGGTGATCT
GGTGGCTTACCTGTACCTGTGATGGAGAATGAATTTTTCTATTTGGAAAAGTTCAGGCAG
AATCTGTCTCTAGGTGGAAGCTTAATGAATATTAATCACTCAATGAGTGCTTGACAATGT
AGAATAAGTCAACTCTATACAGTTGTGTTGGTGGTTTGTCTAAATAAACAATATTTATCT
ATTATAAGTGAGCTTGTCTATTTTTTATTTTTTAACTTTTGAATAGTCAACATTAAGGTC
ACACTATTTGTCTACAAAAAATAAACAATTTAATGACATGACCTTTTGTGTTTTCATTCA
CCCATACGTATCTGCATTTTTGGGGGATAAATGACTAAGAAGATTGCAAGATGTGTAAAT
TGTTTATTTACTGTAAAAATTATTTTAATATAAAAGTACTAACAATTTGATGGATGAATT
TGTAAATATGCTTTAGATTTACATCTTAAAGGTTTTAATTCTATAGCCTTTATGCGAGCA
AAGAATAAGTTTACCCTCAGAGTTGCTTAATGTGATTGCTGCTGAAAATGATGCAGCTGG
CCACAAATTCTTATTTAACAAAAATATATTATCAGGGCCTTAGCTGTTTCAAAACTTGCA
CTGTAACTGCAATTAATCAAATTCGATTTTTACTTCTAACGATTATGAAAAACAATTAAG
AAAAAATTATTGCATTTATAATCCGCTCTTTCCGGTTGTACACTTGTTGCTTTGCAATGC
TCAGTTTCATGTGAAAATGACAACGCATGTGCTGTAATGTAAGGTTTGCAGCATGGCATG
TGCATCATTCATTGACATACATACGAATCAATGTTTTTAACAGCAAGACAGAGATCGCAT
GCAATTGTGTGTGCGTGCTCGGCCTCACGTGAGCAAAGCATATGCATCTAAAATCATCTT
AATGCGAGCGATTTAATGGTCAAATAGGTTTCAGCGCGGTGTTTAGTGATTTCATATTAA
CCACCATTTGTGTAATGATGACGGTACATATTTTACTATAAATTGTTCAAAATACAAGCA
TTCAGATTAAAGTGCGATTCAAAGCCTCAATTAGGCAAGTCATTGTATAACAGTAGTTTC
TTCTGCAGCAATCAGAAAATGTATAGCTTAGGGGGGCTAATAATAGGCTATTGACCTTGA
ATAGGTTAAAAAATATTTAAATCTGCTATTATTCTAATATATTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1079, 1431..1496, 1987..2047, 2290..2326, 2719..2944
NC_007131.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved