Danio_rerio Locus znf687b
snOPY snoRNA Orthological Gene Database
Danio_rerio znf687b
Danio_rerio
znf687b
19
SNORA13
7907..8045
14955
attccgctgtggcaatcccggattgataaagtgactaagccgaaaggagaatgaatgaa
tgaatgaacatgaaatgagggtaagacgtttaagaatcaattacagtatataaagtcatt
acaaaatgagatagttctgtttgctttcttattttcaaataatgaaatttaaatattaaa
tatattaaaatatttaaataactacttgcaaaaaaacctggaaaatatggtttggtatta
gtacatttgcatttgtggatatggaatgaaaaaaaatcagttaaatgtaggctataacaa
aacaagcatttctattagtagagacagattgataataaccacaaataatatctttaagag
taacagaaacatgttgactattatctttaataaatgagccaatatgtttgcaaaattgtg
cgtatgtgtctgtgtgtgtgtgtgtgtgtgtgcgtcagcatcggatgcagctgtccggtg
ccggtgcttcaagtgatctctagatggcggtaaaacctaataaataaatcagatgagata
aatatagcatcattgtgatgtttcttaaaaatgaattctgattactgttgctttccacat
ttctacatgtttcattacacttaacattggtatgagtcttcatcgtaatcctgggctcat
tatatatatacatttttaatgatatatttcctcgtcagacataaaggaattgactagata
cggtataaaagcaatgttatgcatccgtacatgcatttgtgtctgtgcaaataatggcca
aaataaccttagatgtctcgaaatgcaacaatatattgtgaataacgttaatgtatgaca
tatgtttcaacattttggaagcatatagaaaaataaaccttttatatctaattattggct
acaattcttaactataagatatttatagtatatggaaataaatgaacgtaaatcctctgt
gctttagggggtgcagaaatatccgcaatccttacaatcaaggcctaaaccaaatcaagc
aaaagacagtgaaatacgagatcctggaaggacataaatacacaacaaccacacatccat
agaatctaattacaattgtgatgtttttctttgagatcaaaactgtaactgacataccac
aggagatttagatgcaaacttacgcgcataaccaaaaaccataacgaaaaacattttttc
tatctataattgataactttatcttccaagacctggccgtagtcgatcgatgacgggaag
taggcgcttcatctggagcgaggatagtcgggaatctcaaaaagcaggtaaacaaaataa
ctgcctgtgcatgaaaaaacaaaatccgaaaactacacacaccttcattaaaatgcatga
tcatgaaggcacaatgtggcatcagtgtgaggttatttataagcaggtaaacgttgccgt
gcacatgcagtggcctgcgcttaaatgaccctcgcgacggggcagcacagaccccgccgt
cataacagaacaaacccaaaaatacaccccatgtttctatttatcagcccagtagtgctt
tgtttagcagtcagtcagcatacaaacctaatgtaagagacaaaatgtgtcggaaactca
ttattcttacgacagcgattcaattctgtccccatttgttgttagccaggtcagccgcag
gttttagccgttccctgtttgtcaaaacgttatatacataatgaattgtatatacttgta
acgcgttctcgataggaactaaccccctttttcttgtttattgctcaattatattttcgt
acaatgtttttattccatctaacgttaaaggggcttgtttggattctgttgttgatacca
ttgctgctgtagcgtgctaaacaggctctgttaacacacatgtaaatgatataatgtgta
taatatatcataatatctacttgtaaatgtttaaaatgattcattcttatattgcatctc
taaatacgtgttctggttcagccaccaacatctaggttgctatagaggcattacgcggct
gttagccaaagctaacaaaagccgatgggtgttatttgctgtggcacgatgtgtttatat
gtttaaatgaaaacttatacatgtatttttgttgtggaactaaaatgaactattaataaa
tgatgatatacatgattcgtgataattatacgtgaggctaacatcattctcagtttacct
cagaggtaccttagcacgaagcagtgtctgttaatgtttagaaaaagaagagtttgaaat
aaattgatttagttggctttgattttagttggatgttttaaaattaaggtatttaaaaaa
aacagtagacttgccataagctgttgcttaaacttacttagcaccttacacatcacatta
aatcacagcagaatttagactcaatattaaagaatatgagctattaataaatacaatgag
ttattctcttattaaaagagaatttaatgtcaaccagatgttatttacactgtcattatt
tagtaattttgtcaaattatggcattcatgcaagagtatactatggaaattgtcagtaaa
tcgatttgttgaacatgatgtttataatattgtcaataaaacacattttgtacactatta
atgaaattggcattacattggtttctcatttcatttgtttatattttaggattaagtgag
tccactgacccggcatgggggacatgaaaacccccgatttcgatgacctgttggcagcat
ttgacattcctgatattgatgccaaagaagctatccagtcagccccggatgaggtggagg
ggcatcaaggagcaggtggagcatcgcttataaaatctggtgatgcttcagtaggtgaaa
gttctgccttacggtcacccagcccatccacagattcccagagcgacccatctattgtca
gtgtgattgtgaagaaccgcgttcgtcctgagccatttgatggtggcgaaaattcagtac
cagacccactcaaccataatggatttgtgtcatctggtgggtcagtacatatgtctcagt
ctcgaggccagccgaatggtgaacagtggcctgtatgtagctccaaggcaattccagaga
ctgcaggacagcatggatcgtctggcggttccaaacaggggagcaacatcttcaataagc
tgaagcctttgatggcacaaggtgctggagactctgtcgggagggcacggaaaatgcagc
ttctgcaacagcagcatatgcagcaggagatgaaccttgaaggtgcagacaaggcaaaag
ctcctgcaaatccaagtggggcaagcggagcagcatctcctttctttcctccacctaaac
cacttctttccactccttccacagcctcatcctcctcgccgtcatcatcgtctccctcag
ttggctccagagtgtctggggctgtggcctcgtctccgcttgccacttctttaacagagc
cgtttaacggaacaccacgtcttagttcgtctgcatttagacgtgcagattcagaagagg
aggactcagatcctgattctggagggtctttagtcattcatgagagtccggactctccta
cccctccgaaactctcacgtcgacttcggtcatcccctgaaaattcacagtctccttcta
ttcccccttcaacatccatatcaccaaatgcttaccccaaaccaggtgacgtcccctccg
catcacctgcttctcctcgtgcgcaacagaattggctgtcaacagccgcccaaacaggaa
atggaaaaagtttacctcaagaagagagaaacccagagcatgtgattgaagaacgggatt
ctcctgaaagcccagagcctgaaatgcccaagtcctccatgccaacatctgcagttacta
aaagatcctgcagcccagcggccgcctcatccccttctgcagcccttcgtgaacccaagg
aggaagatgaggagatggaagtagacaaagcatctacagagaatggacaagatgcggaga
acacagatggtggtaaaggggatacagataaaatagaggtagatcctgcgcaatcccttg
aagcggagactggctcgtcaacaaacagtgatggaaaagctgcaactggtggcaaagccc
cttctagacctcttaaagtccgcatcaagaccattaagacgtctacaggaggcatcactc
gcactgttactcgagtagcaggtaagggaggtgctgctgccaatgcaggaaaagatgcaa
ataaaggccaaacaggaggtcgagccggtcccgtgaaaggtgggaaaaaaaatgacacca
ctgctggtcaaggcgtgaaatgctcaaccctaccagtatccactttagaagccagtagtg
ccatgctcgctgcagccagcaaggttcaaaacaaaatgaccatgcagtcagataaaacta
aagtctccgccactgcagtgagcatcacaaaagccaccactctacctgtcgcaccagctg
tcggcgggataagcgtacgtcctacagtcggtaaaaccaccaatggagggactatgccat
gtaaaccagcatctatcgtcaacagcactggtgctgttatttctcgaagccagtccagcc
tagtcgaggccttcaacaagatcttaaatagcaagaacttgcttcctagttaccgtccag
atctctcaacccctccaccgcctgaatggggtcttcctatgcctgccgctggctaccgct
gcttggagtgtggagattcgttcgctctggagcgcagcctggctagacactacgaccgtc
gctctttaagaatagaggtgacctgcaatcactgcgcaaaacggctggctttcttcaaca
agtgcagtctgctgctacatgctcgcgagcacaaggaacgaggcctggtcatgcagtgct
cacatttggttatgagaccagttacagtggagcagatgattggccagcaggacactaccc
ccattggtaacttcaaaattctgcagttttctgtgaacgcttaatgtcatacactcaatg
ctgaatgccaaatgttctgtttgtaggtatgctttctccgtcactttcctctccaccttt
gacatcctccactacccctgcagggacgattcctgcaccgtccacttccagtccactcaa
agactccccctctccaggcacggcttcaactcagcccagtcctgcccgtcgtggacccca
gagtcctcaggcattgatgccgctgccctgcaagaaaggcgaagctctgcaataccacaa
cttcaagtgtccagaatgtcaagcccagtttttaagcaaggctgaattagtgacccattt
ccagcaaatcagagctactccaaactcagtaagttctaatactataaacatactagaatt
gtctagaacactttttctatatctgatgacctggttggacgagcaggtctgatttttttt
tctgcagacgtttgaaccaaccctgcatcattttgtttaaacactatttttcagcatcat
gattatatgtgtgtgtactataaaatgactccatggtgcaacacaacatagttaaagtta
ttgtctgtcagtttacacatttactcagatcctgatttttttaaactgacccaaaagtac
atgtatgaacttgatttactaatttcctacactctatttctttttcagacttgcacgctt
tgttctcctcccatgatgctgcctaactggtgcagtgtgtcggctcatcagcggatccat
aaacaccgcgcacctcacgtgtgcccagagtgtggtggcactgcccgccaggccacattt
cagacgcatctggaagagtcctgcctgcattttgctaggcgcatcggctacaggtttctg
gcctaaaaatatttagttaaatcgcaaaacacttactgttatctgcaagatttcctgcaa
gtaaacaaaataaaagtgttgctttggacatgctcaaatctccaaccaaatcttttcctt
taggtgctccagttgtcaggttgtgttcggaggtttgaactctatcaagtcccacattca
gacggctcactgtgaggtgtttcataagtgccccaattgcccgatggccttcaaatctgc
ccaaagcgcccaagggcacatcacttcccagcatcctgcactcacagctgcacaggccaa
gtagggtgacccatcacacacagcttaatacaatttttataatataaataaattctttga
ggttattaactttgtactgtttttacaggatgatctacaagtgtgtcatgtgcgatacag
tttttacccagaaacctctgctgtacatgcattttgacactcatttagccaaacagaagg
tgcatgtgttcaaatgtccagactgcactaaactttatgcccagaaaggatccatgatgg
aacacataaaggtagatatccttaatgttataatgaatttttgtattattattgttatta
ttattattaagtatatttttattcctgaatacaatacaatataataaataattaacatat
ttttctattaatattgttacattataatgtattattaataaagtaataatattaataata
tgctataatgaattgcaatatacaaactacactgaacggccactttattaggtacacctg
tctaactgctcattaatgcaaatttctaatcagccaatcacatggcagtaactcattgca
tttaggcatgtagaaatggtcaagatgatctgctgcagttcaaaccgagcatcagaatgg
gaaagaaagctgatttaagggactttgaaagtggcatggttgttggggccagacgggctg
gtctgagtatttcagaaactgctgatttactgagattttcacacacaaccatttataggg
tttacggagaatgttctgaaaaagagaaaatatccagtgagtggcagttctgtgggcgca
aataccttcttgatgccagaggtcagaaaagaatggccacactagtttaagctaatagtt
aaagcaatggtaactgggctacagcagcagaagaccacacctgatgccactcctgacagc
taagatcaggaaactgaggctacaattcacacaggctcaccaaaattggacaatagaaga
ttggaaaaacgttacacctgtctcgatttctattgcgacatttggatggaaggttcagaa
tttggtgtcaacaacatgacagcatggatccatcctgccttgtatcaatggtttaggctg
gtggtagtggtgtaatggtgtgggggatatatttttccacactttgggcccattagtacc
aattgagcattgtgtcaacggcacaatctacctgtgtattgttgctgaccatgtccatcc
ctttatgaccatagtgtacccatcttctgatggctacttccagcagaataatgcgccatg
tcataaagcgcaaatctcagactggtttcttgaacgtgacaatgagttcactgcactcaa
atggcctccacagtcaccagatctcaatccaatagagcatctttgggatgtggtggatcg
ggagatggattatgaatgtgcagctgaaaaatctgcagcaactgcatgatgctataatgt
caacatggactaaaattcctgaggattattttcagtatcttgttgaacctatgccaatga
aggattaaggccgttccgaaggcaaaagggggtccaaccttgtactagtaaggtgtacct
aataaagtggccagcaagtgtatgtgtacattgtgttcatttttataatattttatgaaa
tagtagttattattgttatttaaataactatctttttttaaaatcattattttattatga
tacaatgcatttaaggattgtttaaatgaaagaatacattgtcattttgccttttgtgtt
acccattcttttcacattccctgaagaatgtggtgtcaaaaaaggcatacagtaatactc
ttggttaggcatttacaaagtgatttctctgtatcacgctgtctaaagctcaaaccaagt
acaacagccgcctcggtgtgcaaattatcatgctatccattccgtatcgctttaaccaaa
gtcgtcttttaatatttcccattagactgctcacagaggcttgtctgtcaaagctgagac
tccgcccaccacctcttctcccgtctccgcccctgccggtaactccacctctaaacccaa
accagcaacagaaaacaattcagatgagctgagccagggcccaggagaggaggaagagga
aggggaagacgaggagggagagcaggaaggagaagagagagaagatgaagaggaggagga
gaatgaggaggaggagcaggtgagctctccagagagcgggaatatggagtggaggtgcaa
ggagtgcaagaagcgatttccagagagagaggattacatcgaccacatgaagaatgaaca
cggaacggttggtactcttaaaaaaataacagagtaagcacaagtaaactgatcaattga
gcttctagcaatttcttgtgactgctgtaagagaaataatatatttagttttatatattt
tgagatctgctttagaaaagcttattgttagagtatatgtgtggtgtttttgttttttct
ttaaaatccattacatgcagtgcttctcacacatacactttacttggtcaggccgcccag
atatattaacagccgcccaattatatttagtatatttaggcccaatcccaattgtacttt
ggtaccctttccccttggcccttacaatcaagggtgaaggggaagggcttcaaaatgtac
ccctaagaattgggacagcacctgcacacgtcatcatgtgtcatcgccatcttatgctcc
atatgagttcagacgatggcgactgctggagtaattccagttgtgctatttttggtgttt
atcttcaggaaatcactgaaggcatttattatgtcatcataaccatctaatgtgccaata
agatcatatctgtgttgtgcacacagtggccatattcatctatgtaaacacaccaaaaac
aacattaacattatagcagacactgtaaaaagcccatgacagccactagacattactagt
gggtattccagtgtcatcgagtgtcagaatgttgtgggattgctgcacaggaatattatt
agagataataaataataaaagtttttattttagcgttttttttttgtttttttttttttt
taaagcaagatggtaaaacacgaacacggttatgaatatatatattaaaatgtgtttgtt
tgttgtaaaaactcgtaataatgacaaaaaatactaattcgttgatctctttacttccgg
gtgcagctgtggctggtgtattctgggaaatttttcttaccccttggtttcgagtgttgt
cctgaaaaatcttcgtttgaaggggtgtataccccttgcctttagccttacgccttccag
ctaaagagaatttcgacaccactaccccttcacgggcacctgcaaaacgagtggtagggg
taaggggaagggctaaggggtagagttgggattgggccctagtgacactttttttttttt
tttactattattatcatccttttacactcttttgtatctacctaatataaccaaacatgc
gagattgattaagtagtggaaaatcctttcttgtttgcccgtttcgttctgtgagtgcgt
gaactctcaacactctcacatgctctaaagacccacagacccatgcacctttctgatact
aaactcgcctatattttttattattaaattattattattgtattattattaaatgtatta
cattataatcatttttaataggggaagtgaaatcttttccaactgagatattacaaaatc
cttagcatttagccttgtataatagttataaaacaaaattaattaaacaaaattattacc
aaaaaaaagttataaaaagtcttacatttcacttggtggaacctacagaaaccctgtcaa
atgtgcttttattttcttcttctaggtaatgaagaaatttccctgcagattgtgcgagcg
ttcattcagttcagccaacagtcttcgtcggcatgtccgaataatacacgagggcgtcaa
gagagtcttccactgcccgtgagtcgaacattactcaactgcaaatcagggttgaaaatt
aacaagggctcgtggtacaaatctcccgcaggtttaagttaagaggggaaaatataaaaa
tatgaattatctacactaatattatatttgtacatgtagtttgtattcaggttaaatgaa
tgaaaatgaactttgcatgcttataaattctcatcataacatacaaaatgcagatatgaa
gtaagaaattaatttagcagcttcagtgattattacggtgattttgtcaaaagtgttaaa
tctatgctaaactaatgacagggactggaaggttttgtatgtgagcctggaatatgtcat
gctcaaatctataaatgtgttaatatgtaggttacagattgatggattgaaacattcatg
ttgatttaggtaattggtaattttttggcataaaagtgtacacgaacacaattaagttat
aaagagtcccgcgggaaatcaatagcactcggcaaatattttccccaaaaggacaatgta
atttctgatactgttacaaattcacttagaccattctattcctttataaaactgtgccat
aattatatttatcttgtaaatctgtctatctcccacaggcactgctcagaaggcaagcga
acattcagtagtcgtctgattttggagaagcacattcgggtcaggcacggcatcagatca
cgacaaacaacagacagaacggtcagtttaaccactctgcctctattgtatgttactgtg
cacacaccacttattcagctgctggaaataccgaatgaatgtctttttattttgtttttt
tattattattatatatttttttttgatgcaaaaaagcctatgctgagctgcactggattt
actctccctccagccatagtcactgtgtgatgtgaagcagctttcacaccggacatagaa
agcaatgcgctatgaaacccattcatttcaatggcttgtgctgtacaaaaatggttagtt
gctgcactgtgaaagtgcaagagcagcagaacaaactattgactactttatgcgctgcgg
ctcaaagtagctcaatattcaactttgtacagtgggggaaagaattattgagcacgtcat
catttttctcagaaaacatatttctaaaggtgtcgttaactttgataacaaccaaaaaaa
tccatatatgcaaagaaaacaaatctaattagtttacaaatgaagttgtgtgttataaaa
tgaaatgacgcagacaaaaagtattgaacacttgaagaaaaggagatgtagaaaggcagt
gaaaggccagacagctgctgaaatctcccagtagttcattaaccctctgcctttcgtcat
tgtaaattaatatcagctgcttcagtttaacatctacattagcaggacgatgaagatgaa
acctggctggacatttcagcaagacaatgatccaaaacacagccaaggaaactctgaaat
gctttcagagaaagaaaatcaagctgtagaatggcccagccaatcacctgacttgaatcc
aatagagaataaaaaataaagatcagatttgatagatgagacccacagaaccatcagaaa
aacaatcaggtagcgtaccaacaggacatttatatctaatatacttgttcctgctgcttg
caataaggctactgtgctatcatgggtaaagtgacacctctcaacttgttcactgtcagt
aaatagttgttgtttgcttgtgtttttttttatctgtataatttgagttaaatttaaaaa
gtcttgtcggtgctagtggtgtagtggttagtgcattgacacatgaactccggtgcttgc
ggcgacccgggttcgattccgcctcgcggtcctatgccgatccttcccctctctctgctc
cccatgctttcctgtcaattatctatactgtcctatcaaaaataaaggtgaaaaccccga
aaaaataattataaaaattttttaaaaagtcttacaaaactacttcttattattgaataa
aataataaataattatcaccaagcatttttagtattctttttcagccaagtgcattcaga
attgtctttttcatctcagaatgtttattttggtacgtaacagttcacatattcatttga
atctcctctcgcagaacgctccgaacactagaaagcgctctcttccagctgacggagccg
gcagttcatcagagctcgacaatgagagcggagctccaccagcagggggcggcaccgaca
ccgatgacgtccccggagaggacacctcgggtccagctaagagaacgcgagcgtctgaaa
accgtccagtggagcaggaggaagaggacgggacattccgctgcacaccctgcggcttca
ccacacaggattgggaagagtttcagaggcacattcccgtccactgtgacgcagagaacg
cgccccagcagtgcctgcagtgcggagcctgtttcgcgtcagccgggtccctcagccgac
ataaattcatcacgcaccgcttacgccaaggtcaacatgacagaaacgcatcgcctggtg
catcaccgcagtatggatccccgtcctcaccgaaagcgggcgaggatggggatggagggg
tcagctgtagggtgtgtgggcgacgcttcgataaagcctcggaccttaacacacacttcc
gcacgcacggcatggccttcatcacagcacacaggaccgacaagcccttgtagaacgaga
ggaggaaataaaataggaaaagccattgaaaaatgggactaagtttattgcaattaattc
gaaaaaaacgtaacgttgttatgatcgtaaggtgacctgtcttccggaaacacacagata
ttaaaagatacttgctctctctttgtaatatcccaaactttttcattttaggtcaagtat
gtatctaagattcgttcgtcttgcttgaaaactactaaagcagtttggcgtctgccgggc
tttttgcgacatccacacgaacattaaagcaaaaagggtgctagtgaagggtttgttttt
ttacgaataaaggaaaacactgacttttaaatgtaactattgtacagacattgtagtact
gatatttatttatattgaagcattcatcggtcttttgataatcactgagaacttaaacaa
caagtgaatggagcgtttgtcgtgtctgtgaggagatgtacagcagaggtcaaatatgga
ttgtaaagttaaagtcatgaaaggtcaatataagtaaacatggattcatttcagtcacag
atatacactcgagcacattttctatgtgtataaatgcagtacatcactttgatatggttg
ttgcattggaaatgtgaacacgttgagtctttgtaatttttattattagctaaaggtgga
tattgaaatactgctagtgaaagcttgcgttcggagacagatgtaattttcatgactttg
tctgaatccagaatcgacactgagtttgaaggattgcttgtgttttatgataaattgtgt
acaaatatgaatgtcgtttgtgtattttttttttctttgataagagtcttttctatcagg
atgtactgtgctcgttgaaaaccacatttcttaaacaaaataatattgtgatcgtgtgaa
ttatgtgtgagtgtgactttctataccttcagtaatatatgtatatgtcccatacataga
cagtctatagacagccatcttattctgtgatgacctgcctgtttcactgccgtacatctg
tgtcagttctctttctaaataaaatggtaaaattggtacggtaaagatttttgtgtcctt
aattattctttatataaaaataattccttacatttatatagcagttttctggacactcga
tcgaagcacttttcacaattttggggaatctcatccacttggatgacacaaaggcagcca
tattgcgccagagcgcacaccagctgattggcggagaggagacagtaggtgtgtccaaaa
tcacatacttatgcactattctacgccattttgtagtataaatagtgtaagtagtgcgtt
cacactgaaaactctaagactaataagtgcactcattcagctggtaaagtggtgtgtaat
gatggacacttcacacaccgaccgcaggtttgctcacgtggtggaaggggcggagctatc
gggcgcatacgttggattactttattttggatggtgaagcaaaattctcctacgagagtg
attatagcgcctccagatggtgaatgcggttatactcgtggcaggttttatttgatagtt
tagtcatttatttctctgatttagcaaacgttatcagggaaacggttcaaatttccgctt
agttaaaaaaaaaaaacattagtgctttatttgggacaacactgcatacatacactgtgc
tgttaagtgtgtaagtgcacaagtacatagtatatattatatagtgtgccatttgggatg
cagctagtgatgaagggtgggttggaggccatgatgtacagaggctgtttggcaaatttg
gccatatttaaaatatcagtggtttaatgtaagggctgcacggtggtgccgtgggtagca
cgttcacctcacagcaaaaagttcgcttgtttgagcctcggctaggtcagttggcatttc
tgtgtggagtttgcatgttctccccgaattcgcgtgggtttcctccggttccccaagagt
cccaagacatgtggtataggtgaattaggtaagttaaattgtctgtagtgtatgtgtgtg
aatgagtgtgtatgga
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1306, 2689..4985, 5066..5367, 5688..5872, 6003..6179, 6268..6430, 8125..8466, 10045..10157, 10778..10880, 12314..13955
2714..4985, 5066..5367, 5688..5872, 6003..6179, 6268..6430, 8125..8466, 10045..10157, 10778..10880, 12314..12892
NC_007130.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved