Danio_rerio Locus rrm2
snOPY snoRNA Orthological Gene Database
Danio_rerio rrm2
Danio_rerio
rrm2
19
SNORD94
3789..3924
7747
GATTATTGTGGTGTAAAGTTTGATCGGCAATAAAATACTGACACCTCTTTGATGACAGT
AAATGTTATATTAATGATGTGGTATTAGTGATATTATTGATGTCCAATATACGTTAATCT
TCGTGCTGAAGGACAGGAGAAACGACAACAAGACATTTACCTCTGTCATACGGAGGATTT
GATGAAGGTATAATCACAAAAGATCACACGTGCAGTTTCATGTTCATTATTGAACGTGAA
TATTGAAGCTTTCTAAAGTATTTTAGGTTAGAGTATGACTTGATGTTGTGTATTTCGAAA
ATGTTTACTCAAATCTGGCGCGAAACCGCATCTTCCTGTCAGGCGGGTTTTGTTGTTGCA
AATGGGTTTATGTCTGCCACGTTATAAAAGAGGTACGGAGAAATGTATTTCCCCAAACAA
CAGTCGATTGTTTTTATTATACAAGATATAATTATCTTAAAAACGTTTATTGTGCTTCGT
TTATTGTGTCATTTGTATGTGATCGACAGCTGCAGTCTTTGTGACTTGAATAAATTCACT
GATAGTTAACGTTACATGCTTTATTTACTTCTAATTCAGTAATTTTGCTTTGAAATAATA
ACAGATGCAAGCACATCAGTGTAAAGGACATCTACGGTAACAGAAAAGACATCTACGGTA
TATAAACCGTTTACTTGAGTGTGGAGTAAAATTATACACATTTATTAAAGTATATCGAAC
ATAAAAATAAAAACATTAAGATTTCACAAATGTATAGTTTTATTTCATATTCGCGCCCTT
TTAAACCTGTTTGTATGGTTTTGTAATACTTTGCAACCCCCAATATGTTTGAATTTCCCG
CGAGGTGCAGCTCTTACGTGACGCGGTGGAGAAATCTGATTGGTTCATCTGATGAACGAG
TTAAAAGGACCAAACAAAGCCGGGGAGTTTGCTCTTTCCCCATTGGCTGAGAATAAGCGC
CAAGAATCGAATATAAAAAGCGTATCCGGCATTCATACTTAGTGTTATCTTCGCTTCAGC
TGGACCGTAGACCTGCTAGCTCTTAGTTTTGCTTTTATTTATTTCTAGTTAACTTTGTTT
TAGAAGTTGTCTTTATTTTTAACCTTTAACTTATCCTCGTTTTGTTTTACCAAACACTCC
AAGCTTTACAATGTCGTCCACTCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTC
TACTAAAATGAATAACATGTCCTTTGTGGACAAAGAAAACACGGTAAGTTTGTTTCTTTG
ACTTTACTTTTAACGAACCGCAATTATTGTAACTACTGCGTAGTCATGCGACCCGTAAGT
TACATTTTTAGGCTCTCAAGAGTAGCTCTATACGCGCATATAACATAAAATACGAATATT
ACTTTAAATACAGCTACTAGGTAGTTGTGTTGTGTTGTAAAATGTGATTTGTTTTGTCCT
CAGCCACCCAGTTTGAGCTCCACCAGAATCCTGGCGTCCAAAACGGCGCGCAAAATCTTT
GATGAATCAGAGGTCAGTCCACTTTTACTTCGTCTCTGCACGTGTCTTCAGAATGAGCTA
ATATTATGCATGTTTATCTGATGTGGTATTAAATGTTTATCGACTTCTGGAGCGATGTCT
TTAAGTTGTAGATAAAATTTGGCGGATTCTGAGCGCGCTAAGTTGGGCAGGTAACATCAA
ACTTATCCGGGTCTTTTTGGAAGAACAATGGCTCATTAAACTAGTCCAGCTGAACGGAAT
TAAAAACGATTACTTAAAACTAGGGTGATTTTTGTGTTTTATGCTAGTTAATAAAACAAT
GCATGAGTTTGGCGGGCGATTAGCTTGAGCTGATGTAATGTTGCATAAACGACGCAGAGT
GTATGCTAAACATGCACTTTAAAGTGCGAATACTCCTTTTCTGTACAATTCGATCAATAT
TTAGATGGTTTTCTTATATTTGCACAACTTGGTCTGGTCAATCAGAAAAGCTCTTGTTTT
GCCGAAAAAATATAGACCGGAAGTAGTATTACTGGGAATGATCAATGCACCAAAAGCAAA
CAAGATGGTCTTATTACTATTATTATTTATTTGTTTTCTGGTAAACGAAGGAAATCGTGC
TAATATTCCAAGTTACAAGAAGTGGAAACCCAAATGGTGTATATAAAATGTTTGATACTT
TAATACAGCTGAGTCTTCTCGTTCATACAAGCAACAACTTTCCATTATCTAAGACTTTTT
TTTTTTTTTTTTTTTTTTTTTGGGAAATGAGAACCAAAGCTAACCAGACTTTAACGAACA
TTGTCAAATGCTAGCTTAGTTAGTAGCTTAGTTTTTAGTATATTTTTTATATACCATTGA
ATAACTTGCTATTATTATTTTTTACAAAATGGTCAAGAATTGCAAGTCTTGAATAAAATG
GTTAATAGCCCAAACAGAAATGAGCTTATTGCTAAAGATTGTTTTTATCCTAGTTACATG
CACCATAAGCCCTAACTCATGTTAGTTTGTTACATCAAACATGTTTTAATTGCAGGGGCA
GTCGAAAGCAAAGAAAGGAGCAGTGGAGGAGGAGCCTCTTCTGAAGGAGAACCCCCATCG
CTTTGTCATTTTCCCAATTCAGTATCATGACATCTGGCAGATGTACAAGAAGGCAGAGGC
CTCTTTCTGGACAGCTGAGGAGGTGAACTTTAAAACATAACACCTTAACACCTAGAAATG
CCTCCATTTAATATGCTGTCCTTACTAGGTGCACCGGTCAATCTGGTTTTGTCAAAGATC
CTGAAAATTAGCATAAATATGAATGAGAAATTTATTAGAATTGATTTAAATTAGAGTATC
TAATTAATAAATTTAGCAAAGTTTTTAATAAACATGTACCAAATCAGCAATTTAATATTC
CTGCAAAAGTGCTAGCCATTTATCAAAACATGACCAAAGAGACAAGTTTACGAATTTAAC
ATGCATTTATTAGTCAAATTTACAAGTTATTTTTTTTCACAACTAGTGCTCTTTAAATGT
ACTTGATATAATTAATCCTCCTTGTTCTCAAGCTATTAAGTAACTTGTCCTTTTCAGTGT
GTTCTAATGGCCCTGAATATAATTTAAATGTCATTTAAAATTTGCATATTGCCCTTGGCT
AATAGTTTAATGTAACATTCAGCCTTTATTTGCTAGCATGCTTTTTATAGTTGCAATGTT
TTGAACACTTGGGTTTTTATTTTTTCTAAGGTTGATCTGTCCAAAGATCTGCAACACTGG
GATTCCCTGAAAGACGAGGAGAGATATTTCATCTCCCATGTTCTGGCTTTCTTTGCTGCA
AGTGATGGCATTGTCAATGAGAACTTGGTAAGCTCATAGGCAAACATTTACAGCCTGGCT
GTCAGTCAATTTCTGAAGGGCCACAGTTTTGCTTTAGCCCTCATCAAACACAGCTGATCT
AAATAATCTGTTCAAAAGAATCTTGAACCCTTAATTGGCTGCATCAGATGTTTGGTTAGG
GTTGAAACAACTGCAGCGCTGTGGCCCCCTTCAGAAATTGACTTATACCTATGATTTTAC
AGGATTTAATTTTTTCCCTCCCCCCCTTTTTTTTAATTTATTTATTTTGTTAATTGGTCC
TTACCACTTGTCTTCTGACTCTAGGTGGAGCGTTTCACTCAGGAGGTCCAGGTGACTGAA
GCCCGCTGCTTCTATGGCTTCCAGATAGCAATGGAAAACATCCACTCAGAAATGTACAGC
CTGTTGATTGACACCTACATTAAAGATTCTAAAGAGAGGTAAGTGTTTGGACCCGTTTTG
AGGTTATTGGGAGCAATGATGAGTGGCGCAGGGGTACGTACCTCAGCTGATAATGGGAGC
TGAGTGTTGACTGCTCAAAATCAGTGGACATGTGGTCAGCTGGTTGTAGGGTGTCAGCAC
GAAATTATCGCCTTGACTGAGCTCCCTAAAAATGCTCTTGTAAATGGTACCTAGTCATTT
ATCTGACTAATGAAATTGTTTTCTGTAGGGAATTTTTGTTCAATGCCATTGAGACAATGC
CATGTGTAAAGAAGAAGGCTGACTGGGCACTCAACTGGATTGGTGATAAAAATGCACGAT
ATGGTATGTTATAAACATACTTTATTAAAAAGGGGAAAAAAAAGAAAAATAATTATAATA
AAGTATTAAAGGAAGTTTATTATTAAGTGACCGCTAATTTAAGTCTTGCACTGGTTACAG
GTGAGAGAGTGGTGGCCTTTGCTGCAGTGGAGGGAATCTTCTTCTCTGGGTCTTTTGCTT
CTATTTTCTGGCTAAAGAAGAGGGGACTCATGCCTGGACTCACCTTCTCCAATGAGCTGA
TCAGCAGAGATGAGGTAACCCTTTTGTCTACCTTAACCCTAGTATGCACCTATTGTAGAA
TGTGGTACTAATGTTTCTTATTCTTGCAGGGTCTTCATTGCGACTTCGCCTGCCTCATGT
TTAAACACTTGATCAACAAACCATCAGAAGAAACCGTGAAGAAAATCATCATGAATGCAG
TTGAAATTGAGCAGGTTTGTGAGCCTTCATAACAAGTGCTTTCAGTCAGGCCAGTGTTCA
TTTTCAGGTTTACACAAAGGGCAATGTTCATTAAAGTTCTTGCTGAATAAAGCTAGATAG
GTTTCATCAGCATGACTACAGGGCAGTTGTTTTTACAGAATAAACTGCCCTGATGTATGT
AATCTGGCTGCTTGTCACAGAACTGAACTATTAGATGTAGTAATTTAACTTTATTGAATG
TAACAAACAAACATGACTGAACACAACCTGCAGTTCCAGATTTGAATTTTCTTTAGTTGA
AGAGCTGCATGTTAACAATGGATTAATAAACTTACTTTTTTTTTTTCTTCTCTTGCATTT
GAGTGCTAGAGTAAAGTAAAGCCAGATTTCGCTTGAATGATAAAGCTTGTGGTTTAGAAG
ACAGAACTTTTATTCCGCTAAACACCTGCCATAATGTACTTTCTTGCTTGACAACTTAAC
TACAATTGCAGCCTACAGTAACTTACTCAGCCACAAGATGGTGGCAAACAGTCTAAAAAA
GGGGCAAGAAAGAACTGAAAATTGACTAATGGTCAAGATCACTGGTGCTCAACGCTGTAC
CTGGAGGTCTAGCTTCCTACAAAGTTCAGCTCCAACTCTGACCGAACACGCATGAACCTA
TTAATTAGAACTAACATGCGTTGCAATGTCTTTGGCTTTTCAGAATCAACTATTCCAGAG
TGCTGTATAGTATTGAGATGTAGTGTGGTCGATCATATGATAGATATTCCCACTTTATAC
AGTTTTATGTGTGCTTTGACCACTTATTTATTGGAAAGGAGGGCCTATGTATCAGTCTTT
TTTTTTTTTTTTTTTTTTTTTTTTGACCCCTTATAAATAAGGGACTAAACCAAATAAAAA
TGAATAAATTGTCTTTTTTTTTTTTTAATAATCAAGTCAAAGTATTTTCAATTGAATGGG
TAGACAAGACCTGACAGGGTATGTACTTGCATTTTAGTGTCTTCTACTTGTAATTGCATC
CTAAAGTAAAAACAATACAGGGCATATAGTTTTAATAATTTTTGTAAACCACAAATCTGA
CTTGTTTATCTTCCTAGGAGTTCCTGACTGATGCTCTTCCCGTGAAGCTCATTGGCATGA
ACTGTGACCTGATGAAGCAGTACATTGAGTTTGTGGCTGACCGACTGTTGCTGGAGCTGG
GATTTGACAAGGTAGGTTTATTTCATTAGTCTTGAGTCTGCTCATGGTGGCAGTGTAGTC
CTTGTAATGTCTAATGATCTGAGGTCTGTCACATGTCAAACCCGTTTTGTACTTTCAGTT
CAACAGGTGGCACTTTAAGCGTCACTAACCTTCCAAATTGCCTTTCTAGGTCTATAGAGT
GGAGAATCCTTTTGACTTCATGGAGAACATTTCGTTGGAGGGCAAGACCAACTTCTTCGA
GAAGCGAGTGGGCGAGTACCAGCGCATGGGAGTCATGTCGGGAACTACAGATAACACTTT
CACTCTGGATGCTGATTTTTAAAGACTCAATCTGAGTGCTTCAACGGACACTTAACACAA
AACTATGGACTTCTGGGACTTTTGCTGTATAGTTTACATGTTTTTGTTTAACTTTGTTTT
AGCGAGATTAGTATTAAATAAGCTTTTTATTTTTGTTTTACATAATAAAAAAAAAAATTT
GAATTTCAACTTTTTGGATGAGGTATTGCTCGAAGTATCAAGTTAGGTTTTTCAAGATAT
GGTGGCTCAATTTAGCCCAGACTCTATTTCGTGTAAATGAGGTAAAATGAGTTATGGAGA
TTTATACTGCATTTAGTAGCTAGCTTGCCCCAGAGCAGACTAATAAGGCTAAGACTAATC
CTAGTGATTTTCTGTTAGTAATTCATTTAAGTTACTCTGGCCATTTACTTATATTGGCAG
TATAGATAATATTTCTCACTTCCATATAAAGTATGGGATCGACTCATAAATTAAGGTACA
AATATAGAAACATGAATGGATAAAATAGATGCTCCAATATTGGGTAAGAGTATGCAGTTA
GTTATTTAATAAACTTTCCTGCATAACATGGTTGACTTTTGGTCACATTTAACACAAAGT
AAACCACTGCTAATTTGATGGTTATACTTTGGTGTAGGTAACTTTACAGCATCTTCCCAA
ACCAGAACAGGGTTCGAGACATTGCCACACTGTCCATCAAATTTTTTTTTTTTTTTTTTT
TTTAAATCAATAAAGAGAAAAATCGTTACCCTGGCTTTCAGAATTTTACATTTCATAACT
AGCTTTGCTATAAGAAGCCAATAAATAGTGATGTGTATATTAGGAACTGCCATTAAATGA
TTCAAGCTTAGTAAAAGAACTGTTCACCAGAAAATGAACCTTTACTTAAGGTTTACACCT
GTGATCAAGTGGTTCCAAACTTAAGAATTGCTTTCTTGTTGAACACAAAAATATACTGTG
GTGAATGGTGAAAAAGCCTGCTACAGACAACCATAGGAACAAAAAACTAAGTCAATGGTT
TTTAAATTATTATCTTTTTCCCCCCACCAACATTCAGTTCAACGATTGCTTCCTTTTGAA
CACAAGTTTGATCAAAAGGAGAATTTTCATTTTACTGTGAGCTGTCACTTTAATTGAAGC
CTAACAGTTAAATGCACTATGATGGTTTTCTTTATGCTCATCTGTAATGAACATCAATGC
TCACATGGAAACTTCTAAAGCACTCAATATATTTATAGTAGCCATTATCTAGGGCACTCC
TGGCATGAGCTGTTGAGCAGTCGCTCTCTTGTAAGTGCTCTCGGGACGTTTTGATACTAT
TTGTTCATGGGACAACATGCACATCAACTTAAGAAAGAAGTCTTTTGACCTTTTAATACG
GCTCTACAATCCACAAACTTCTGCTTATTGCATGTACTCGAACACATGTTACATCTTTCA
TTGCTGTACGTTTCTATTTTAGAGTTTGGGCACAACTGCCATTGAGTTGTCAGTTGATTT
GAGCTGCTGTGAAAACGGTGATGGATGGTCATGAAGGTCTGAATCTTACTGTTAAAGTGA
GAGTATATCAGAATAAGAGCAGCGATTGACTCTTGGACATGTAGATTACTGCGAGGATCA
TTTCTCCAGGTTTTTCTCATTAGCGTGCCTGTCAGCGGTCCATTCTGACAACAGCTGCTT
TAGTTGACCCATCCACACACAGTAGATCTTGTTAGCAGCCATTATATAACTAAACAGCAC
AGTGCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1242, 1443..1511, 2515..2661, 3210..3326, 3624..3757, 3988..4082, 4200..4333, 4409..4513, 5597..5710, 5869..6747
1150..1242, 1443..1511, 2515..2661, 3210..3326, 3624..3757, 3988..4082, 4200..4333, 4409..4513, 5597..5710, 5869..6021
NC_007130.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved