Danio_rerio Locus si:dkey-154b15.1
snOPY snoRNA Orthological Gene Database
Danio_rerio si:dkey-154b15.1
Danio_rerio
si:dkey-154b15.1
19
SNORA9, SNORA9
1777..1908, 2127..2258
7799
GACAGACGCTTATGGGACCTTCTTCAGACAGACAAAAAGACAGACAGACAGGGAGACAG
ACAGACGCCTATGGGACCTTCTTCAGACAGACAGACAGACAGACGCTTATGGGACCTTCT
TCAAACAGACAGACAGACAGACAGACAGACAGACGCTTATGGGACCTTCTTCAGACAGAC
AGACAGACAGACAGACAGACAGACACACAGACGCTTATAGAACCTTCTTCACACAGACAA
ACAGACAGACAGAAAGGTATGTGGGTAGGTAGGTAGATAGGTATTGGCATGGCTCAACAA
GTAAAGTTTAGTTTAGGCTATTCTGTGTGTGATGCCAGCATAATTACTAGTGCTATGCTG
CCCTCTTATGAGTAAACAGCAGGATTTTTCCATCACCTTATTAGATGAGCAGACAGCTAC
ACAGGTCCAGGAACAGTTCTGAATATAAAAGGATCAAAATATTGAAATGATTAAAATTCA
CTGGAATCTGCAGGTAATTGTTAATAGTATTGTATATATTGTATACCCTATTACAAGTAG
CTATGCTGTGAAAAAATATTTCAAAAATGTGAATTTATTACAAGCCAACAATTACGCTAA
AATATATATGTATTGCAGACCAATTTGTCATAAAGACAGATTAATAAAATTATTCTATTA
ATTATCATATTACCAAATAATATAATTTGGTTGTTAGTAAAATGTCTTAATAGCATTTGC
AAGTTTGTGGAACCAATAAACCTAGCACAGCTGTTGTTATCTACTTAAAGGAAACAGATT
TGCACACAGTTACAGCGTCAAAACAAACAATTTCAGTAAATGGTTATACCAGGCTACAGT
ACTGTATAGCCACATTTTCAGTCATGTCGGGGTAGAATGTTCACTTACCAAAATATTGTA
AGCTTTCTGTACTTTACTGTCATGTTCAGATGGTGGCAGTGACGTGCCAAAAGCCCTAGC
CATTAAATGTCAGAAGAAGAAAAGGCCGCTTTTCTGATGACGTGATTTCCGGCTCGTTCT
TTCACAGGGGAACGGCTGTGGTAGCAGGAGTTGTGGCGTTGAGTCTGTATTTAAAGGTGA
GATTTGATTATTAGTATTTAAATGTTTCAGCATTATGTTTATTGTCTGTCTTGTTTACAA
TGGTATGTAGTTGTACAATGTTTTAAAGGTAATTTTGTATGCATCAATATATACATGAAT
GCATTTAATTCCGTCATTATTGTAACATATCGTTTGTCCGTTTTAGGTCATTATTGTAAA
CTTGTTTTACTTCACCTGTGTAATGTAACTTAGTCGTATTTTTGTATGATATGTAGATTT
TAAAACGTTTTTCCGATATATGCACGTGGTCACAAGCGTCCACGTGGGCCACATTGGCTA
TTCGATAATTCGATTTAAACCTTTTTTTTTGTTAGCTCTTTTTTGCATCAGGAATTAACG
TCTTTTAAATCATATCTATGGCTTAGATTGATAACCTTTATGCATCATTCTGGAAAGTTG
TCCAGTTTATTTTTGCGTTTATTTTCAGCATCTTGGCAAACAATTGTTAAATTTCACAAA
CAATTTCTCCCTCATTTGCTTTTAATCATTTTGATTTAGGAAATGTTACAAAAATGCTCT
CACATAAACAAAAAAAGCACCTGCTTAGCCTTAGGAATGTGGAAAATGCTACATTGTTAA
ATAATGTAAACCGTTAAAGTGTAAAATGATTCTTGACGGATTCTTTGTTGTGATTGAAGC
TTGTAGTTGTAAGTTGGGGAGTTGCTGTGCTGTACTTCTGCAGGCTGTTCAGCGAGGCTG
AGTCTCCTGTGACTCTGTCCTTTCCTTTATGTCTGCTAGATAGACATGGAGTGGTTTGAG
ACCCTGTTGTCTACTAAATACAGCGTGGTTATAGAAACTCCAGATAAACATTCCTTCAGG
AATGTGATTTAATGTCTCACCTTTGCTTGTAAAGTTATTCACTGAAGTTGTCTTTCTCTT
ACAGCATACAATTTCCCTGAATTCTGTGATGGACATTCATTCCTAAGGATTGGTCACAAG
ATGGCGATTCTCAGCTGCTGCAGGAAGTAAGTTTGCTAAGCATGTTTTGGACCCATTTCA
AAGCAGCGGTTTATTACAGAACCGTCATTGCAGGCTGTTCAGCGAGGTTGAGTCTTTGTG
ACTCTTGCCTTTCCTGTAAAGTCTGCTAGAGAGATTTGAGGTGGTTTGAGGCCTGCTGGG
ATTCCCTTCTCAGTTTGGTTATGTAATCTTCAAACATTTGTGATCAATCCACCACAATTA
TACACTACATCTATAAAATGTTAAAGTTTTCTTCTTCCTTTTACAGTGAGGAACGCTGGC
TTTGCTGCGATGTTGGATCATAAATTGGTAATCAAGTAAGATTGAATATTGTTGAATAAT
GTAAAATTGTTGATTGTAATACTTTTTGCATAATGTGTTGGTTCAAATAGTAAGTTATAT
AGCAAGTTATATTGAATGTGAAATTATTTGCAAAGAAATGTTTGTGTGGGTTAAGTTTTT
TTTTTTTATCTGATGAAACTAAATAAAGAAATATTATAAAAAAATTGCTTGTTTTCTGCT
TTTTGCCCCTCTCAGTTTGTCTTTAAAACATGTTTATGTGGGATTTCTTCATTCTGCATC
TATCAACGGTTTTGTCTTGTTTTTGTGATCATTTGAGCTGTCTTACGAATACAACCTAAC
ATTTTTAGCATTAAACAAATGGGTAATTAAAGTTACATTTATGGTTTTCACCAAATAATA
CATCACTATCAAAGTGTCTAAATTTTACAGATATCAGTCAATCAGAAGGCATGGGCTAGT
AGTAAATTTTGACGGTATGATTAACCTTGGATAAAAGAGATCACAGTTTTATGATATTTT
GATTACTGCTCTGAAATATATTCTATTTAAATGTCTAGAAGAAGAAAAAACTTCTAGACT
TGCAACTTTGTATTATGTTTTCAAATTGAGCAAAGGTCATGAAGTTGTATTCAAGTGAGC
TTCAGATGTGCAGGGGTTTTTTTTTCTCTCCTACAAAAAGGTAAGAGTTGGAAGCCGGCA
CAAATTCCACCAATAACACTAGTTTCAATCCACAATGAGGGTCTTGAAGTTTATCAGTGG
AATACACAATATTAGATTTTTATTTTTTGGACATTCTCTAATACTGGTGTTATGTTTTGT
ATTTTTATCACATTGCAAAATACAGTGAAATGTATAACCTTTTCACAATATTGCAGTTTA
AAGATATTCTCAAACCAGAGATCTACTGCACTAATCTGGTTTTGTTTACAGTACACACCG
CCATCTAGTGACGTTTGGGTGACCCTTTGGTGATGTTTATTAAAAATATATATTGAAACC
GTACTGTTTTTAACTCCGTAAGGTAGACATAACGTACAATTTAGAAAGATATAACAGGTG
ACAGTTTTATAACTATTTAAAATGCTGTATGAACTGTAGTGTAGACTATAAGGGGAAAAG
TGGTTATCAATTTTTTATGGACTTGCATTGTTCTCTTTACGATTAGTTTTGATGACTGCC
AAAATATACAAATTAAAGTAATTTTATTCCTTTGAATTTGTAAATTGCATAACAAATTCA
TCACATGTATCTTGGTTTAGCGGCTTTTATTTATTTCCAGTCTTGGATAAGTCATTGATT
AAATACATTTAATTTGACATTTATGCAAATTTTAGCTTTTTTAAAACAGAAAAAAAAACT
TTTCTAAAACTCAAAGAAAACCGTATTTTGTAAAGTGTCCTCCAGTCCGCTGCAGATTAA
AATACTTAAAGGAAGTTACTCGTAATTTTTCTGTGAGAGCTCAGGCACGCCCCCTTGTTT
TCATCAAGCTCTGATCAGCGCAGTTTCACTTTCGCTTCAACACGAGGGAGTATTTCTTTA
ATTTTTTATCCTGGCGAACGAAATTATACAATCAACCACAGGTAAATTTCTAAATCTGGA
ATCCACCAAGAATCACCGTACGCTTTTACTTGTAAAACTATGGGATTTCCTGTTACTATG
GCGATATGTTTTGGTAAAACGCCAGCTGTAAAACTAGTTTGCCACGTTTTATATCCCAAC
AACTTTCTTTTTCTGTTACCTTAGCAACTAGTAATTTGCGATCTACTCTTAATACATAAT
ATTTAAATGCACATTACGTTACTCTTAATTTAAATTACAATCAATCTCATCCTGTATTCA
GTAATGTAACTAACAACCGAATTCTGAAATGTAAACAAACGTGCACTAGCAACAAGGTCT
AAACACTCGCCGTTTCAGTAGGGATTAGGTACATTCTTTTTCGTGTTGCTGAATTGTTGA
GGAATTTGGGAACAATTTGTGAGATAAATAAAGTTATTAATTTCATATTTTTGTTAACGT
CTGTACAAATGCGTTATTTTCTGAATGCATTCAATCTGGGTTCCATTGTTATAGTTTATT
TCTGATTTTGGTTTGTAGTTGACGTGGTATTGGTAACATTTAGAAAGTATTCAGCATTGG
TTTAATTTGTTTGTCCAATATTTTGTTCATATGAACAGACATCTAAACTTTAACTAAAGA
AAGAAATATAATGTAATTTTGTGTTGTAATAACTGGTTATTTGTAACTTTTATCACAATC
ATTAACAGTTATTCATTGCTCAGTTTTAGGATGGACATGACGGGAATGGTTATTGAAGTG
AATGGGCTCCCGGACAGCTACCGAGAAGATGCAATGATTGACAAATTAACTATCCATTTT
CTGAGGCGCTGTAACAAAGGAGAAGATGTTTTAACAGTGATTTATCCCACTTCCAACAAG
GGCCAGGCTTATGTAGTCTTTGAATCAGAAGAGGGTATGATATTATCCATTGTTATATTT
TTTACCATATATACTGACAAACAAGTCTTGTGTTTTATAATTATTGTTGTTGTTGTTATT
ATCAATATTATATCCAAAATTTTAGTTCCTGGAGTCTTGGAACACACTCATGTTTTGCAA
GTGGAGAGTCAGTTTTACCCACTGGTTGTTAAGCAGGTGGACCTGCCTCTGGTAAGAAAT
TTATTTGTAAATAAACAATACAGAATTGTGCATTTTACAAGTGAATATAGTAGTCAGCAT
GTCTCATAATTTACTACTGATTCCTGATTATCATCTTGTTTTACAGTACATGTATCCTAA
AACTAAAGTAACAGTAGATCAATAATGGCAAATATGTTTACCTGACATGCTTATGTTCCA
TTCATTTTCTTAGCTGGACATGCCAGCCGAAACATTTCTCAATATGAACCTGTTCTCCAG
CCACAAGAAGATTGTAGAACTTCTTGATAACCATGGCTTTCAGGTGACACCGACCAGATC
AGGGCAGATGCAATTGCAGGGTTCCTTTCTCAAGCTTCAACTTGTTTATCCAAAGCTGAT
GCAGATTCTTGCTGAAGAAACTCACTCTCAAAGGACACCTTCTCACTACACTAATGGCTA
CTCAGACTCTGCCTCCAGAGCTGGCTCAAGTGACTATGAATATAAATCCAGATCCAATGT
CACATCAAGATACAGACCCAATAATGGCAGCTCAGTGTATGTTATGTCTAGAAGCACATC
TTCAGGAGTAAAGTCAGAATCTCCAAACAAGATGGCATTTTTGCAGACTTCCTCAGTACA
CAATGGAAGCTCCAGGATAGATAGTTCCTTTAACAGTCCCTCCAGGAACTATGAAGATAC
ACCCACAAGCATCCATCGCTTGTCTCCCAGGAAAACTGAGGATTCCTTCCATGCAGATCC
AGATGTGATGGAATACATAATGCATTTCAATGAAGATTCTGTTGAAAAAATACAGTCAGA
TTATCGCACTCATATTAGTTACGTTTCAGTGGTTGATTCAGAGGTTGTTATGGTTAAACT
CTCTAGAGGAGATTGTGAGGAAGCAGCAAAAGAATTGCGTGAATTGATAGAAAACTTCAG
GTCTTCTCTATGCACACAAGAAATAGATCTGAATGAACTTGATGACAGTCATACAAACGA
GATTTTTCGGAAAGCAAATTCATTTCAAAAGATCTACAAAGTTTTAATTAGGCATAAAGG
TAGCATTATTAAAGTGGTAGGGTCATCGCAAAACAGTTATGAAGCAAAGCAAAGGCTTCT
TGGAGAAAAGGTTGAATTTGCACCAGCAAAACTCATGGAGAGGAATGTATTGCGACGCAG
CAGCTCTTTGACAAGAAAAAACACAAGGCAGAGAATGGAGAATCTTGAACTTGAACGTCC
TGTTGCTCTGAACACTACTTCTGCGAGTAGCTCTTCTGCCTCACGTTTTCAAAAGGACTC
TGAATTGCAGCTAGAAGTACCACAGGAAAGAGGTAGAACACCTAAATCTATGACACAACG
TGTACGCTCACAGAGCGCCACTCGATCAAAACACAAATCTCAGGGTAATCAAGTAAACCG
GGAACTGTCAAATTATGATCAGCAGAATTCAAAACCATCTAATGAAGCCCAGAAATCTAA
CCCAATACCAAAAATCTTAGCTGCTCTTCGACCTGAAACAAATACAAAAATTCATCAAAA
ATTTTTCAAAGTGACTAAATCTAATAAATAAGACACACTGATGACAACTTTATTTTCCTG
GCAATATTTTCTTATAGTCTTTATTAGTATGTAATATTGCTGTGGCAAAGTTACAAAGCT
CAGACATCAACTCCAAAGTGAGGTATTCTTATTCTAACAGAAAGCAGTTTTCAAGAACAA
TGGTGAATGGCTTTTTTATTTTTTATTTGTGAATTCCAAAAGAAATTCATTTGATAATTT
AAGCTAACCAAAACACAAAAGAGGAAGGACCTGGTTAATCTCATACAGACAACAATCTTT
TACGTTTTAGACATGTGTTGGTATTAGGGATGTAACGGTATCAGAATTTCACGGTACGGT
AATACCTCGGTATGAATGTCACGGTACGGTATTTATTGAATCATTTACAGGAAAAAAAAA
ACTTTTGAAAATACTCCAAAAAAGTGCCAAAAGTGTCAATGACATACAAATTAGCCATCT
ATCTGTTAGCTTTGAAACAGGAACTTCAATTTTAATAACAAAAAATTATTAAACCATGTA
AAAAAATTAAGTTTCAATTTAGTATTGTTAAAAACTCATCACATTTAACATTTAATCACT
CACTTAGATAGAGATGGGTTTAAAGGAAAATTATCATATAACTATAATCTGGTAAAAGCT
GGTATCTCTGAGTATTTACAATGTCCCCTGCAACAGAAAAAACCCCTCTCATTTGGGACT
GAGGATTCTGGGACAAGAGAGATATGACTTGGCCCATGTTGACAGCAGTGGGGTAACGTT
GTGCATTGTCTTTCCCCCACTTGAGAGGACAAACCATGAGTGAGATAGAGATCTCTTTGC
GGTACAAGTCAATGTCTGCATCAATCTGAACAGTGTGCTGTGTTTCTGCAGTCCCCATGA
CTGTTATTAGTCGTATTCCCCAACTTGCTGGCACGTGCACACATAGGGCTCAACCTGTGC
AGTGCACATGCCCTTTTTAGTCTTGGATAGAAAATGCCCTTCCAAAACGATCAAAAGTGC
CCCCGCGACGCGACACAACCTCCGTCCAGTCCAGCCCTTCAGTAGGCGCGCGATAACACC
TCTCTTGAGTATGCGCGCTCAACCCCCCCTCGGCGCTTTACAATACGCGCGCCACAACAC
AGCTGATCAGAACGCGCGCGACAGCACCGCTATTCAGCACGCGCGCGGCGACAACACCCG
CTTTAGGTTCGATCATTTCCATCTTTTTTTCATCTCCGCTACTAGCAGCACACTCCATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 1984..2065, 2326..2366, 4643..4833, 4945..5030, 5233..6799
4650..4833, 4945..5030, 5233..6570
NC_007130.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved