Danio_rerio Locus LOC100535315
snOPY snoRNA Orthological Gene Database
Danio_rerio LOC100535315
Danio_rerio
LOC100535315
19
SNORA16, SNORA16, SNORD99
2337..2472, 3190..3324, 4290..4361
5598
TTACTGAAGGCCTGTGCTCCTGGATCTATCCTAGTGGAGTCTGCTTACTCTGTCCATGG
TGCTGAATGATAAATGTGCGGCTGGGGGGCGTGTGGTCAAAACAAGTACTGTCCAGAAAA
ATCCGATAGACTTTAATGATAATAATAATATAATAATAATAATAATAATAATAATAATAA
TAATAGTATTAGTAGTAGTCGTTAATTCGCTTGTTATCTAACCAACCAGATGTTACTAAT
CCAAATGTCATAATTGTATAGATTGCCATAATCTTGTTCATTTCTTTGTTTGTTAATTTA
TTCATTTGTTTGAGCAAGGCCATTTTCAGCTGAGCACGGTTGTCTCATTTTTTAAACATA
GTTTATTTGTTTATTTTGTGCATATGAGTATTACTATTTTATTTTAAAATAATTATTTAA
GTTGCCTAAATAAAACAGTGTTGCGAGATTCAAACAACATCTTTTTTTCTTTCATTTTTT
TTCTTAATTTTTTTTATTCAAGAACAAAAATATACAACCACAATCAGGAGATCAATATAA
GAGAGATACGAATGAGGAAACATACAAGCTACATTAGCTGCAGGGAAAAAAAGACTAACA
AAACAAAGAAAGGGTTAAGTTAATTACGATTTTATAAAAGCGTATGAAAATAAATAAATT
AAGATAATTAAAGGAAACCTATCTAACTGAAATCAGAGTCAATTGACAACCGTTCTTTAT
AGTACCAATCGGACACATAATTTGTTATTATTACACATACGGAAAGATTTCAGCAGAAGC
AGCAGAAAATGTTGAAAAGTAGGGAGTGAAGCCACGCATTTCTTATGTATAAAAAATTCC
GATCATTATAAAAAAAATAATAATCTTATTACTATATTAGAAATCCCAGTCGTCATTTAG
TCGCAAAACTACATATCCCATCGAGCTGTGTGACTGAACAATGTCATTCAGCCAATCAGC
GATGAGCCAGTTCACCAATCAGCGTTAGTTACCGCCGTATAAAACATAACGTCACAGTCT
CAGCTTCCTCCTTTTCAACTGCTTTCTAAATGGGTGAAGGTGGGTACGAGTCAATCTTTA
AACATCGAATGCTGTTTATGAGTTTGAAGTTTTTAAGTCGTCGATTTTGTCAGTTTGATT
GTTTCTCCAATATTTAGTTTGAGAATTGTTGGCTTGAGTCGCAGGATGTTTTAATTCTTT
GTGTCTTTGAGATGTATTGTGTTGGGTGGAGGCGAACTCTCAACAAAACGCATTCTATTT
TTATGATAAAAGCTACCGTTTATAACTGTAAAAGAACTGCAGATAGTAAAAATTCCGTGT
TTTTGTCGTTTCAACTAAGTAACTTTGGATGAGGCGCCATTACACTCTACACACATGATT
AGCCCTAAATACTTGCTGCTAACTTTTGTGCGTTTTTAAGCTAACTTTTTTTCTTTTTTT
TTTTTTTTTTTTTTTTGTATCTTTCAGATGTTAACGTTCCCTGAAATGGGAGTTCAGTTT
AACCACGTTGTTCCACCGCTAATCACAACTTTCTGTCCAGAGGTAAAAAAAGATCTTTAC
ACTGTATTGATGCTTAACGTTTTAAACTGTATAGCATATTGAAGTCATTTAGGCCAAATC
GTAATATTACGTTCGGTCATGACTATGGCATTGTTTTTGCCATATGCGTACAATTGTGTT
AATCTTCGGATTTGAGAAATTATTTTGGTAGTATAATAACTTTAAATCTTAATATATGCA
ATCAAAAGTAATACCTTTTTACTTCATGTTTTAATGCAAATTCAATTAGATCCACTTTGG
TAAACGGTAAGCCTTATCTAACAAACTGTATTGTAAATAAATCATGAATATTTTCATATT
TATCAATTGTATTACTGTAATAAATCTGAATAATTACACACAAGTAAATAAACAGAATCA
ATGATGGGATAAAAATCTGAAAAGATTGCGTGCAGGCCTAGTCATGATACTTAAATGTTA
ATTACAATGTGAAACTCCTGTTTGGCAATTCAAGTTGTTGAAGATTTAAGTGGGTTTTGC
AAGTGTGTCTTGCTGAATGAAAACTCTTTTGCTATACCCTTTAAAGAGTATAGTATACGC
CCAGTGTCGAGCTCACCTAAAGATATTTACTATAGTAGTTCCAAAACTTTTTTTAGGTTT
ATTTAATAAAGTATTTTGAAGAAAGCTGAAACTGACAATTGATTTTCGCTTGAAAGTAAA
TCAGTTACAGGCCTCCAATTTTAAAGTCCTCTTAACAGAAGAGACCTGCTTGACTTGAAG
GTTGAGTTAATTGTTCATGGGTAAACTGTCCCTCTTAGTAAGACTGAAGTCATTTTTCAA
GGCCCTGATCGAAGCTGTCCTGTTCATCTATAGCAGGTACTGGTCAAACAGGAGCCAATA
GCAACACTTTTACCGACGGTCGCTGTACAGTTTGCTTGTAGCTGTCCCAGCAACATTAAG
GAAAAGGACAACTGACTAATTTTTTTTGGTAAACGTTCTACTGCGTGTAGCCTCTTTCTA
ACTTTTTTTTTTTCTCATGCAGGTTGGATGATGCAGAGCAAGCTGAATGTGTGCACCTGA
AAGAAACCCCATTATGATCTTCCTTGATGGGGGCTGAATGACCAACCTTGAAGGTTTGTT
TGTTAATGTTTTTTTTCTTTGATTAAACCAAAGAGGGGGGGGGGGGTAATATGGGCCCTC
ACAGTAAAACTACATTCATAGAAGGATACTGGGGTGCATCCTTCAGAGTGTTTTATACTT
AGAAAACTTTATTTATCCCGCAGGAAATTGCTTATGTAATGACTGCCATAACACACAGAA
CACAGAAACACAAAACCACAAGACAAAATAAATAAATTAAGTGAAATAAGTCACATAAAT
CCAACCAATCTATAAAAGGAAACAGCCACAATACATAAGTATACAAACTATTATATAAGA
TATTACACTTAAAAGAATCAGTGGTAACTAATACTAATAAGTCATATATCAAGTAATGAA
AATAATATTAACCAAAACTAATATTACACATAAAACAATTACACATACAATAATGTGTAC
ACATAAAACAAATGTGTAATGGCCAGATGAGTTCGACTTAAGGATACAGAATTGACAACC
AACAGTGACATTGGTCTATCGTTACACCTCTAATTGAACCATAAGGTATATTAAAGCTTA
ATTGGCTTTTCATGGCCCTGATTGAAGCTGTCCAGTTTGTCTGTAACTGGTGCAGATCAA
ACAGGAGCCGATAGCAACACTTTTACTGACGGTCGCTGTGCAGTTACCTGTAGCTGTTTC
AGCAACATTTAGGAAAAGGACAATTGAATGCTTCCCCATTAGTTTATTTTTTATTTTTTT
TTATTTTTTGTGTGTTAAATATCACTTGTATGTAGCTCTGGCTAACTGTTACTTTTTTAT
GCAGGTTAAATTGTGCAGAACAAGCTGAATGTTTCGACATGGAGACCTCCTGTCACGATG
CTTCTGGATGAGCTAAATGAACAAACATGAAAGGTTTGTTTGCTATTGGTTTTTGTGTTT
GTTGGCTGTGATGACAAACTTGCCCTCTCTGAGAGAGCAGCTCTATTATGACAATCAAAA
ACTTTGCTGAGCCAACTGTAACTCTAAGGTTTTATGTTTTTATTTTTTTTAATTGTACTT
AGTACTTGACTAAAAAAAAAAAAAATTCATTTTCTATTTAGCCAGATGCAGTCAGTGCAG
TGCTTTTCAAGTGGCCACAGTAAGCCATTGTTCTGGTAAGTTCAACATTAATTTTAGTGT
TGCACGTATGCGAGAATCAGTGCTCCTAATTTGCGCTTCATTCTCTAACTACGTGCTAAA
TTAATGGGGAGCCTTTGACCGCCTGTCTGCTGGTGTCTGTGTCGGTCACTCTACTGTCCA
ACATAAACCAACTGGTTGCGCATGATGACTCCCCATCTGGGTCCAAGATTAACCCCTATA
GTTTAAATTTGTACCTAAGATTGAAGCTTTAGCTCATTTTAAGGTTATTTACACTCCCAT
TACTTAAACTTGTAAAATTCACTTAAGCTTTTATTATTATTATTTTTTTTTTAGAATAAC
TTAACCGTTAAAATACTTTCTGCCATTTTTATTTTATCAGACATGTGGAGGGTGAGCTTG
TTTTGAATTTTGTGACTGGAACACGATGATGTTACAAATGTATAAATTGAATATATTTTT
GTGCTTAGGTGCTGGTTAACTGTAGGAATGGTGGTACAGTCTGCTTAAGTAGGTATGATT
CTGTAAGCTTAATTTTTATTTTTATTTTTGACTGATCAAGGATGATAGTATATTGATGGT
GACTGCTGGATGAAACTTGCGGATATGGGACTGAGATCAGTTTTTGTTAAACATTTTAAA
CGTGCTTTGTTTGTTTTGACTAACAAAGTTCTGTTTATTTTTCTTCCTACAGGAACTTGA
CTGGTGCGGTTGTCTCAACTTTAACTGGTTTACATGTGCAACTTTTTTTTTTTTTCCCCC
CCCAATAAACCCTTTTAAATAAAAGTATTTTAAAACTATTCTAGACTGCTGTTTTGTTTG
CAAATGATACTAAAGTAATATTGGACCATAAATTTAAAACAATCAATTATTTTCCACCAA
TATGTATTTCATGTTAAATAAGTTTGACTTTATGCTGTAAAATAACAAAGATACATGACA
ACTTTAGTGTAACTCCATACCATTTTATTACTGGAGACAGGTGTACAACAAACCAGCTGG
TACTTGACAAACTCCATCACAATGAAGAAAATCTATTAACTTTCCCCCAATGGGATGTCA
AACCTTATTGTCATTGCATACAAAAACGATAAATTTCATAAAATAAAGCTACTAATCTTC
TGATGACCATTGACGCGACCACTTTTAAAACAACATCCTCTTCAGACAGCAGGCCCTGAA
AACAGGAGAAAAGAAAAATGTTCTTGCTGTAGATATAATAACATTTAACACTGCCACACA
AGTGTTGCCTTACCATTTACTGCTTTTATTCCTGAGCAATTGAACGTAGTTTCAGGTCTG
CAATCTCCAAATCAGGAGAACTACTGCCACTTCGGTCACTGTATGCATCTCTGTGAACAC
AAAACAGCTTTAATTTAATTCTACATAAAAAGCTTATCACAACTAATGGCACTGCAATGA
ATCAAAACATTAACTGAGATCTTAATTTCCCCTTTTTTATTATGAACCATCTTTTGAAGA
TGAGATTGGGTAAGAGAATTTTGACTGCTTATGGAACATGGGTCCATACCGTGGTGACAA
TCGACACCCTTTCTGCAGGTAACTTTGAAGCCTCCCTGCAGCAGCCAAAAGCAGGCCCAA
GTATGGTGGCGATGGCTTTATTGGTCTTGATGTGAATTCTGGGTGATACTGAACACCAAC
GAAATAAGGGTGATCTGCAAAAACAACAAAAAATCATGCTATTTATTGTACATGTAATAT
ATTACTATGACAATCCTTAAACCTGAAAAGTACACAAGTCAACAAAATATACAACCAAGG
TTGCCAATTATCAATTTTTCTGACTAAATAGCTAAATTTTCATAACATTTAATGAAAGGA
AAAAGGCTGATATTTATAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 2542..2632, 3424..3512, 3701..3754, 4208..4251, 4432..4598
NC_007130.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved