Danio_rerio Locus eif4g2b
snOPY snoRNA Orthological Gene Database
Danio_rerio eif4g2b
Danio_rerio
eif4g2b
18
SNORD97
6974..7157
12381
taatgcataatctaattttaaaaaaatgttttttattttcacgaacttgccttgatttg
cacacaagatcttctgctgtgtgccctgtgcgttaagtgacacaatgtatacatttaaaa
aaaaaaatctttcatttacaacagtggttatcgtggtacgtgtaccactagtggcacgtg
gactgccttctatagtggtacgcaatccaatatgtcatacatgcaacatatttaaaaatg
tatcaaaaatggttaatttattaatatgatgacatatagcctgtatttatgaggtccaag
caccatttccaggttttgatgaataggatactataggttaacactttacatttaagtaca
ggagattctttaaaatttttaagaacagtagccttccattttcaaagaacttttagaagc
acattttaatttaaacactgacattttattttgtttgtttgttataagcacatcagtgtt
aatgttcaaactatttataaggttcaaagtggccaataataatgaatattattaataata
gtaattaatctgccacgtttttaaactgtgcagagctgtagctgcttaattgggtctact
acgctactgtatttaaatactggtcatatggtggtagcctacttggagagacaatttttt
tctgaggtggtacttgatgaaaaaagtttgagaaccactgatttacaatatttaattgta
acatttaatttcatttttgtttgtattgttttttgttgttgctttgtagctcaaaaataa
aacaaacaggaaaagttgatctgttgggcattccccaacccttcccaatcatggagggcc
aaaccaaaggatacaaagggccaaagggcctagtttgggcatttatgttaaatgggatgt
aatctcttgatgtaaatgatacgatcgttgtatgatcaaccgttttgtttttgatcaaat
aatgtttttttttttaactttcacatgagaaaagtaaaaatgcacaagaagaccattcca
atatataaagccgatgtggttcacaatgtggaaaattactaacaacgaagtcctgacaaa
tacaaatcaagttcctgtgtgacgtcaagcagtcagtcaggaggagcccgagctcaatat
ttctccgccacagcgagctgcaatcgtgcctgaccggttatcttctcaatcctctcaaaa
gcatatctattttcatattcaccctttttctctttaaaaagaacaaaaccaaaaacaaaa
ctgaggttgccttagtaaaggtaagtttctgttatttaacataagataaaatggctgctg
ttgttagtgcgtgaatgtagaaaatggcgtcgctgtagaacaaacacctgagaacgtttt
tgcctttaaaacctaaaacaagttagcacatgtgttagtcattggatagattcatttatg
tatatcttatcctctctccgtgttttaaggggagtacattgttacgtgaccactaaccgc
atgctagctaactgttacgttagctattacgcaaaagctgttattaactgtagtaaaaat
attgagttatattcgttgctgtcttgtgtttaaatgatgtgatatatgtcgggtttagaa
aatgatatagaccgaaagtaacaagatatggcttgtttgttggtttttctttgttatctc
ggttactgtgttagtaagctatcgtaaagatttggcctcttttgtcatgaaaggaggaaa
cgacaagcttaacgtactatttaatggcagaataaaatatttttaaaatattacatatgc
ataaaacgtgattaggcctattcatctttggaggaagagtaaatctctgaacagactagt
aattattacatcgtgtgtgtaatacgcagcgattgttaaacaagtaattttctcacgttt
ccttaactttttttctttccctgttttcatcctttctttctccaacagttcggatttccc
caccccgccctttgataattattcttttgaagattcttcgttgtcaagccgccaaagtgg
agagtgtgattgcagaagggggtgcttctcgtttcaggtgagattgaacatcaagcattg
ccattggacttaaacatatttcttaacgtttgagtcatcaatacaagcaatactgtgtag
ttaaagaacatgggaatctacatcatagatgtcttattaaaggaccagctcaagagcaca
caaaatccatcacaaaaggtggtcgttttgtattgattcttttttttaaataatgtctaa
taataaatccacctagtatttaaatgtttacaaccacaaaaagcacactacatactcatt
acagtattcaggtttgtaaataagaggtgctggtgctactaaaatattatattatagtta
catcttgaacagagatcatttgcataagtgttacatatcatttcacctttatgtaaaact
gcttaatgttaaaacattgtcagacgcaaaacaaggaagcaggtgactggccagaaggaa
cttaagtgtgcttgatctgaacaaatatcaagaagttttttcctaccttatttgtggtgt
gagcacttgcaattcaatgcaaattagttgatgtaactaatatttataatgattaaagat
ttgaatttgtttaccctatcaaatttcacagaagttagcagtgacaatggcaatgaggga
taaagctagtgtttagattcaatgtagatttaccatgttaacctatacatacacctcttt
gtttagcttctttttgaggcacccaaaaaaaatgggttttccccaatgctgaagcttatc
ccatactataatctgtgggtcacagatgagtacttttttttccctgcatcataataagtt
taaatgagtaaatttatgtacaaaaaaaaattattcaagtatatatttttagtggaaata
aaatgtcaaagcaaaaatactggttgtattagtaaattgtgactaattatgaatatttgt
aagcgtttttgtatattttggggctgtactgtgatttttaagagccatcaaattgtttaa
atctaaaagtgcctggcaagattatttcagatacttttttttttttttggtttatgaatt
tttgtggctttgaatcacatttttgttgtcatcttctgtaaattattttaaaaaaatatt
aatatttttgagtgcaacttttcagattaaaacagcatgtttttattataaagcaaaaga
aatggcaaaatagaatagtttgttgtacttcaattaataattaaatattttttcatattt
gacccatgcataggtctgctctcatattaaattgcatgaacattgtgtaatgactggcat
ttctctccatcgcacactgattcagttgcgttttagacccaagcatctgcattgacgtcg
caccagtcgccttgagcaagtggacagttcaatcgatttaacttatctcatgaccgaggg
gtaaagcttttgcctgaatttttaaaaggatgttttgaattgaaaattacattatttgac
tgtttttaaacaagatggggaactctttgatgggtgtcttaaaatgtcttgcacattaaa
aataaaaagtggtgttgctttttgtctagctatttagctgaaactttttaaactgctttc
tacaccaacacaaattgaataaccataaaccagttctaagtatttcttagtggtggttgt
gtgattacccttcttatctacaattgtttttattctagtgcttcttcgggcggaggagga
ggtaggggtgcatctcagcactatcccaagactgtcggcaacaggtatgctttgttaaat
ttaagaacattaaaactttgtaatgtacttcagagactaatggcttgtttgctcttgtag
cgagtacctggggaaaaccccagggcctagcgttcagagatgggttccttcacgaagcac
tagacgagatgtcaactcctccactgaaaaagaacatcacgatgcaatatttaggaaagt
aagagggtgagtgtccttaaggagcataaatgcacacttcagcagcgatggagattaaag
aaggctctgtttctgagcttttgtttattgtgctcattgagtcttgtgagcatgtttttg
tgcttgtcagctgacgctctcaagctcaaaaaagcacaaatctttgtgataaacagcttt
ttttttgtttgtttatttgtttaaactgatatgagatgttcatttgtcttctctctcttt
tagcatacttaataaactgacccctgaaaagtttgacaagctatgccttgagcttctcaa
tgtgggcgtagactctaaacttgtcctcaaaggaatcatcttgctggtgagcgggttttg
cattcattttttgatttaattataatgtcaatcttctgtggcttaagttcccttaaataa
gttaaattcttatcatttgaaatcattataattaaaatattataaagtatacaagcctgc
ttagacgttaataatacgccagcttataaaaagtttcagtgcttaatgtaataattaata
gtcttaaaagctgcttttgaataaatatatgtcatgcattactgtaatctgactatattg
ttctctctaccacagatcgtagacaaagccctagaagagcccaaatacagctcactctat
gctcagctatgtctgcgtttggcagaggatgcaccaaactttgatggcccaacacctgaa
atccagtcatcacaaaagcagagcacagtaagtacatgaatgtactaaacttgtttattt
acatcattaatgtattgtaaaaattcccaaaaagaattctcaattaccctctagttttgt
tactattcattatactgtctatttgcctgcagactttccgaagacttctaattaccaagc
ttcaagatgaatttgaaaaccgcaccaaaaatgttgaccgtgagtcattttatttcttcc
ataacctagatgttttgtgctaattgcaaagcatgatttgtgtccagtttctaaaattga
aatgtgtgtctgcatttagtctacgacaaacaagacaaccctctcacctctgaggaggag
gagcagcgtgccattgccaagatcaagatgcttggcaatatcaaattcattggggaactc
ggcaaacttgacctcatccatgaatctatccttcataagtgcatcaaaacagtatgtatt
agttgaactacatgatgtgatttggttaatagtgagtcagtgattttaagggggtcatca
cttctactttatctgtagcttttggagaaaaagaagagggtccagctcaaggacatggga
gaggatctggagtgtctctgtcagataatgaggactgtggggcccagactcgaccatgaa
aaagccaaggtacaacctgacccactgaacttttttttttttttttttcagcatcggttg
aatagattgattaaaaaggcctatttatacatgctttttattaatctttttttttttttt
tttactttcaaggataaaaaaaaaaagctttctttacgagtcttgattcaaacacaaacc
caaaaaatacctcttaaaagaataggtataaatgtgaacgggtctcgccatctgcttgtg
ttcctgccaattagaatgccatattagtagtggggtatagagtataatgctagtttaatg
cctttcagatgttagacaagttttttaaagctatcaagatatatagatttttatttgaaa
catcattgcattttatatttgagatgctaatgggctgatttatggtgttcagggtcaggc
ttttagctataaagttgttgccttttgaaaactgacagattggtacagtttcattgtgac
tttttggaagcagttttacccatagcaccttgaaggcaaaacaaatcttcagacagaggc
agacttttttttcctgcaggagttttaagtggatgatatattcattgagtagcttaagtg
taatttgagcatgttctctcatacgcctctgctttccccacagtctttaatggatcagta
cttcggccgtatgcaatccttaatgaacaacaaggatttgcctgcgaggattcgtttcct
actgcaggacacagtggagctgagagagaacaattgggttcctcgcaaagctttcatcga
caacggaccaaagacgattaaccagattcgtcaagatgcagtgaaggtaagccagttaca
tttacacaaaactacaaatatcttaatgctgttagaagtcactgattcttttattagaaa
ccaaagcattggttattataattgtttatcttttccttttcaaaggatttgggtgttttc
attccacccatgaaccaaggaatgagaatggacttcttcctagaaggcccctttatgccg
aacaggatgaaactggatagagaaactctgggtggtttggctgatatgtttggtcagatg
ccaggttagtttagcacctgttgtattcatcagcttcatctagattgaattttccatgtg
ttgttcatctttcctgtataactatctgcaggtagtggcatagggactggtccaggtgta
atccaggacaggttttcgcccactctaggacgtcatcgaacaaatcctcttttcaatggc
cacatggcatcccaaccccagtcccagtttgacttgggtatgaagcctttcatgaagtct
aaccaggtatcagagggctgtttttttttcagcaacgacatccatcatttgcattttttt
tacagtttaactgttagtattagattactaaattcctatatctttagggacagaatcagc
attttcacaatcaaaaccagaaccatctgaatcagcagcaggctcaatcaaaggacatgc
ctccacgcttcaagaaggggcagatgaatgcagacgaggtaaacctagacacattaaact
ccagaaaaaccaaagcaccctgtgattataaaaagacgcgttattctgagggattccact
ggttgacagtttctttctttccatcttactgtttttttcttcctttgctttacctcctct
ctatgctgctcctcctctatccctcaatctttaactgccagccagtccgctgattgcgat
tatgagatatgagggtgtaacctgtcaccatagtctcaaatatgaaatcttgatgagtaa
cctaacagtgttttcttgtgatccattctttcagatcagtcttagacctgcccagtcgtt
ccttttgaataaaaaccaagtgccaaaactgcagccccagattcccaccatgattcctcc
cagcgctcagcctccacgaacacaaactccaccactcggacaggtagaaatctctatcag
ctctttttgaacatttttagttggaattgatatttatttaaaactactttttattgtgca
ttataaaaattcatgctgttcttttttagcctcctcaacttggactgaaaaccaacccgc
ctctgattcaggagaaaccccagaagactactaaaaaaccaccacctgctagggaggaac
tgctgaaaatgactgtgggtgtttctaatattgtaaaacgttttatttctgtggttttaa
gagactttataacagattacttgttttgaatacaacaggagaacattgtgaccgagtatc
tgaacaataggaacatggaggtcgctgtcagcggtgtgagagagatgaaagctcccaaac
actttctgccagagatgctgagtaagatcatactgtgttcactggaaaggactgatgaag
accgggaacaggctagcactcttattaacacactgcgtaccgagggcttcatcacagggg
aacacttcatgcaggtaacttccttttgcgaattaattttttttttctcaatcaaaaggt
ttgtcgagcttttcactgttaattatatgtgcttttgtaagcaggctctgctgaatgtct
tggatcagtgccctaagattgaggtagacatccccctggtgaagtcctatctagctcagt
ttgcagcaagagccgtcatcgcagagttggtcagtgtggcagaactggctcatccactgg
agaatggcaaccactttcctcttttcttactatgcctgcagcaagcttccaaactcaagg
accgcgagtggctcacagatctcttccagcagagcaaggtcaacatgcagaagatgcttc
ctggtaagtctacatagagaaattttgtataatttttatttaaagatatcttattttatt
taactagagtttgtgtttctcagaaattgatcagaataaggatcgtatgctggaggttct
cgagggaaaaggtttgagttttctcttccctttgctcaaactggagaaggaactactgaa
gcaaatcaaagcagatccctctcctcagaccatctacaagtggattaaagacaacatttc
tcccaaactccacattgacaagggcttcatcaacatacttgtgactaggtactttctcgt
gaatatgaatggtgaaatgtagttagaagcattattgacaagctcatgttttgttcaaca
gcttcctgcagtatatctttgctgagcttggtgtgcctgaatgcgatgagcaactgtcct
tcccttctaaagagcagctcgatcaggagaagcagctattgcactcttttaagccagtca
tgcagaagttccttcacgaacacaccaacttgcaagtcagtgctctgtatgccctgcagg
tgcactgcaatgccaatgcttttccaaaaggtacagaatgcacataagattgttacattt
tgtctgttgagattttctgaatgactaaatgagaatttttctaatttgaggtttgtggct
ctgacttgtttttgtgattcaggtatgttgcttcgctactttgtccacttttatgacatg
gagatcatcgaggaggaagcatttcttgcttggaaagaagatatttcccaagaatttcct
gggaaaggaaaagccttattccaggttagtttatttgactaatctcggcagtttcatcaa
atggaaaaaaggttttgtgtggctttttatttttacattttctaatgtattaaaaataaa
aaaataattatattttgtattctacttttaatgtttttctccatcaaacctcctttaaat
ctttaactttcatgtatgtgagagctcgacagcactggggcttccattttaaagttcagg
agcatcctccaaaaatgaatgagcacctctactacaaattatttattaattaatgtattg
taattgataacaatttcattaattctgagataacttgttgaaattatagttattataata
aattaagtttctttccaacatactcgcaggtgccaccctcagtattttccgaggtcgcct
ctattcgcttgttaagtgatgacgtgttagtaacgtatgtaatactgtttctgggtccaa
gctgccgcttatttgaattgagaatatattggtttatgatcactttttattcatatcgca
caataaagttaattttatatatagtgtacacaacagtctctaactgttgttttctaacag
agaaaacaacagtctcacaacagcatcacaaaaactaaagtttaacaattaaaaaaaaat
ttatcactttcgtcagccctgctcatcagtcaacttgaacattattctttcaatagccaa
cctggtcctttacagtacagttatctttcataagctgaaaagggcaagcttctttggtga
tgtgtgcagtggtaaatttcacatttagctgccatttgtgttaaacatcggactctattt
tcaaaccgtatgccctctctgttggtggatcgacattcatcacatgatcatcgtcactgg
cgtcattatttgtaacctaaggtggtttacaaacctgtttttattccatcttcttcagtc
ctttaaattttctgtggtgttatctgacagcagaaagttgtgactgagagattgacagct
aatattaacctaaaatctgcatagcacaagagaccggtcgacatatgaacacacaacatg
aatgcttttaagagcaaacaaatgctcccagatgtatttttaggttgcatagattatatt
tcaggtatttttatttttgagccctgtatatttacaagcctttatcttcgttttcaggtg
aaccagtggctgacctggcttgagacggctgaggaagaggagtcagaagaggaagctgac
taagaaaccagactaatcctagtacaacattaattttctgctaaatggcctgccttgggg
gttctacactctttttgcagtagctcactctgttgactaaagtactctgctgctaggctc
gtgaattaaacagcaataccgttattgtaacatctcttaatgcgtttgcttgcgtcataa
ccattgtcaggcttttttaaaatcgacatcagtttcacatgttacatcaaccactgctct
ttttttttgtagaaaaggtgttcgtcagatcctcctcgtggtatgcctggtttaatttgt
gtgtttgtttcagaaaagaaaaacaggacaaacctcgcagcgtctgagcagcagtgaagc
tgagatcctggttgtaatgggcttcataggttacgctgtagactcttattagtgttattg
tgggtcggttgcaatatccttcaaccctcgagcatgattgaaacatctgtaaaactgtaa
tcactgtaacatttagcagtcttcatttctacctcctaccgaatgagcatttgttagtac
agcctctatgtcggatttcatgaattacgatctagagcatctgcttagtagttttgtttt
tgcacaacacactacctaatatctcagcttgcagtagagtttaagtgctttccattgaag
atgccgaaatcaagctactagtgtcaacttaatgcctctgcagccccagccttactataa
tgttgtctgcagtgtgatctacgagtataattgagatgtattctttctctaatggcagtt
gtaatgtttccaatctggtcccattgatctgctacaaataattccaactgtgatggattt
tttttttaacctgccttttaatggggcattaaacgtaaatggaacaaatccttgacaccc
aaaaagaggagaaaggcttttgccctcgtcaataagaggtttacttacaaccttttattg
acaggtgttttaattgtacctgacttgcatttgcccactttaactgcggtgcagttgtca
gaattgaaataacttatgatcatgtcgttgtaaggctgtttagtgctgtattcatcacca
ctattgctgaatttacaataaagaaaaaacttgatcacttaagtctgtctttttttccta
ttttattttatattttttttaaatgttgcactaatattttttttcaatcaattataacat
gagggaatattgtatggaccgttttttttttttaggatttatttttgcctgtattagata
ggaccttattgcgacaggaagtgaagttagttagagggggggtgggggtaggttagggaa
atgacaacttaattcttatgttcaatccacctaaatttaagttaatcggtttgtgttgag
atgacatgaataaattgtgtagaaccctgcattttttttacagtgtattctctgtaatgt
atttaccaggggcagactagccatagggagcaccgggagtctggcctgccctcccctctt
cccgtacccgcattcaccagctcttcacttattgatcgccgtaatcaaccatccccaccg
cacacttttcagttaccgatcaccacagtccacaacatgacacaaaccccctactctggc
tcttcacttcacacacaactccacaacccccagctcctaatttaccaatcacttgggtgg
tcagaggaacaataactttcccgactgaaaatacagtttcagtctgcccctggtgttcac
actcatagtttggttgtattagttttttttatatatatatataatggtctggaccacaga
agaaaaaattggtcagatctttggcattttataagctggaaaacaaaaataaaaaaataa
tcgcaatatattttgtgactgaagtgttaaacatgctgtgtgtgtgcgtgagtgcttgtg
tgtatacgtatgtacgtacgtacgaagattgttttgagtgtttggacgacaaatgtattt
cgtaggttaattgtttacaaaatttaatgcaatctacactcaaaatatatatttgctgcg
tgcacaaaatttatatgaattaacaattcttgggattttttggaaggacgacgttattct
ttttacgttcagtccactcaaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1279, 1968..2076, 3758..3823, 3900..4025, 4263..4365, 4635..4766, 4892..4958, 5059..5210, 5298..5408, 6043..6225, 6345..6483, 6571..6725, 6827..6937, 7234..7362, 7469..7573, 7658..7873, 7964..8222, 8303..8507, 8581..8789, 8902..9023, 10197..11381
2036..2076, 3758..3823, 3900..4025, 4263..4365, 4635..4766, 4892..4958, 5059..5210, 5298..5408, 6043..6225, 6345..6483, 6571..6725, 6827..6937, 7234..7362, 7469..7573, 7658..7873, 7964..8222, 8303..8507, 8581..8789, 8902..9023, 10197..10262
NC_007129.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved