Danio_rerio Locus rbmx
snOPY snoRNA Orthological Gene Database
Danio_rerio rbmx
Danio_rerio
rbmx
14
SNORD61, SNORD61, SNORD61
2911..2988, 3268..3330, 4232..4308
6965
TGCTGTTCCTATTCATTAAAGGTAAAACCCCCCAAAAAAATATTGTAAAAAAAAAAGAA
AATAAATAAAATAATTTTTCATATTTTAAAGAAATGGCGGGCAAACTTAAATGCAGTGCT
TTTTGTGCATTCTGATACCCACTTTATCTTGTATATCAATCAGGCAGGGAAAATCATTGA
CCCAGGTTACTAGAAAATTAAAAGTGCTTCTGCATATGTCTGCATATACCCTATTCTCTG
TGATTCTCTACACCTCAAGAAAGAGTTTTTAAAACAGAGCATGTTTGTAATACAAAATGG
AGAATGGAGAACCACTGGAATCACCATATCTGCTTCAGTCAAACAAAAAGATTTATTTTG
TACAATAGCATAGTGGAGATCCATACAGCTGTGTATATTAACCTGTATCCTGTCACATTT
GCTGCAAGTAGACATGCAAAAACAGAGTAAAGTTAAACATGTGTGCATGTGTATGTGTAC
TGCAAAATTACTCTGTACTGCAAAATACTGTAATGGCAAGTGTGGGACTCATTGTTGCAA
AAAGGCTTGAATAAATTCCACAATAAATATATCAAATAAACATACTTGGCATTTTGACTC
ATAAACTGAATCCAGGCTTCATTCGTGTCGGTCACTGTGACTGTGCTGTTAATCTGACGT
GACACAGCAGAAGAAGGAGACACATGGAATGTGGGTGGGGAGAACCAGTTTACTTGCGCT
TGCACCAGCTACAATCCACAAAATCCACAAATTCAGCGGGGTGTAACAAATGATGGGTAT
TACATACACATACTGGAGACAGTAAAGACTTGTCTTAAATCTTGTAAAACAGGTAAAATA
GGAGCCCTTTAAAATAAATATGCTAAATGCAGCTGTATTAATAGCTAATGAACTACTATT
AACATCTATGAATATTAGTGTAAAATTAATCAAATTTCGTCTGTTTTCGCAGTTTGTAAA
CAGGGCACCAGATGGCGTAAGAGACTTCTCAACCGTTGAGTTCCACTTCCTCTTTCTGAC
CGTCGAGTAAGTGACTGTGTTGGGCGGGTCGAGACACAGCGGACACATATAAACCAGCAC
ACGCTTTTGTCTTGTCTATTGATTCTGAGGTGAGTGAAAGATGGAAGGCGTTGTTAACAG
TGTTCATATTATATAGTTTTGTATATAGACACGTGATATTTTTATGTTTCAGGTTAATTT
AGTGCCGTTCGTCGCGTATTCATGCATGGATATTTGCGGGTGCAGCCGCAACTGAAAGTG
GTCTCATGTAGCTCATGCCAGGGGAGAATTTTTTTCTGAACGAACGTTTACATCGCCATT
TTAAGTTCGCAATGTGCAGTGTTACTTGCTTGTATATCTTAATCTGTATATGTTTTTAGC
GCTATCATCGTTATGACTATATGAAGTGTTTAATTAAACGTTGCAAGTTAGCCATATGGC
CTGAAGAGTTCCCAGGCTGCTTCGCATGCATTGCGTCCGCCATTTTGTGAAGCACGCTTA
AAATGCATATCTATCGTTAAATAAACAAACTAAACAAGCGAGTCCTTTTGTACCATTTTA
AACGCAACTAAATGGATATGAATGTTCGCCCGTGATAAGCAGTTAATACTACGGTTAACT
TTATCAAACGCGTTATCAAACGTATTTTCGATCTTTTTAAAACCATAACAACGTGTATGT
TACGGTAATTTTTGGTTGTTTGTTTTTATTATTGTAACTTAGTTGAATATTAAAGAATAA
ATTTTTTCAGACCTAGGTTTCCTTGTTTGTACTAATATAGACCAATTCGGGAGGACAGTT
TAGGCTGAATTAACGTTGCTTTATTTCATACAAAGCGTGTGTATAAAGATTCTGACGATA
GAATAATCTTTGATAAAGATATCACGGTCTCACGATATTGTGATTACTGCTCTAAAATAT
ATTTAATTTTAAATGTCTGGTTAAAAAAAAACTCCCTTTAAGCACAATATATTTTATTTT
GAGAAGCATTAAAAAATATTTTGGAGCAGTAAGCATGTAAGGCTTTCTGATGTCTTGTTT
CAAAAACACATTTCTTTACTATTTAAAACGGCATCTTTGGATCCTTTCTGCTGAAGATAC
TGTTGTCCTAAAAAACAAAACAAATAAAAAAAATCTTACACCTACCTTAGGAACTGTATA
GCAGAAATTTTTAGCGGTTTTAAAACCTTGACTTCTCCAAACACGGTATGACTGTCATCG
TCCAGTGCATACAATGTGTACCTATCCTGTAATAGAGAAATGTATATTTTTGCAGTGGCA
TTAACGTTACTGGAAAAAAATGGCAGAGGCAGACCGACCTGGGAAGCTCTTCATCGGTGG
CCTGAACACTGAAACTAGTGAGAAAGTCCTCGAAGCCTATTTCAGCAAATTCGGCAGAAT
ATCGGAAGGTAATTTTCATTTTGTATGATCTAAATTGTAACGTAGATGTTATGACTTAAA
GTATAATTAATTGTAGAGAGACTAGCTCAAACCTAGTGTTTGTGGCATTAAGTATGGTTT
GTATCTTTTCTTGTTTTGTGTAGTTCTGTTGATGAAAGATCGTGAAACGAACAAATCTAG
AGGTTTTGCGTTTGTAACTTATGAAAATCCTGGTGATGCTAAGGATGCTGCCAGAGAAAT
GAATGGAAAGGTAAGTACTATCTTGAAAGTATAAGTCTAGGATGACGTGTTATAGTAGCT
TAATCCGAGAAGTAAAGTAGTTTGGAGCCGATTTTAAGCTATTTTTGCAGTCAAGAACAC
TACAGTTATGAATTCTCATAAATGGATATATTTGTGAAGGCTGAATAATTGATCAAAACC
AATTGATCAAGTTAGTGGACCATTGAAATCAATAGAGTACAGTGCTTTCTTCCCGTATTA
GTAAATAATGATGTGAAAATCACATTTGTAAGCTGTGATGTTTTTTTTTGTGGCAGTGAT
CTACTTGAGCTGATCTAGTCCACAATTTCCTCTAAGAAGTTCTGAGCTTGCCTTGTGATT
TATGTCTAGTTTCTTGTCAGTCTTTTTAACATTGGAGTAGTTTTCTAAACCTGTACTTTT
TGTATTCAAGCCTCTTGATGGAAAGCCAATTAAAGTGGAGCAAGCCACAAAACCTCAGTT
TGAGACTTCAGGACGCCGTGGGCCACCACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCT
GCGAGGGTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCACCAAGCAGAGGTACATTCAA
ATAACATTATCCAGTTATTTTAATTGTTGCTGTGATGACACATTCTTGATGATCTGTTTG
AGTTGATTGTCCTCTAAGAAGTTCTGAGCCAACGCTTAACATCTATACTTGCTGAGAAAA
ATATTTCCAAGATAACGTAGGAATTGTAGAACCCTTTTTTAAAGGCATGTCGTCCAGAGG
GCCACCACCAATGAAAAGAGGCCCCCCAGAGCGAAACGGAGGACCCCCACCCAAGAGATC
TGCACCTTCTGGGCCAATGGGCAGACGTAAGTTTGGCTCTTTTTTTTTTTTTTTTTCCCC
CCTCTCTCTCTCCTTATGGTAAAACTTTTGATCCATAAAATCCTTAATGTTAACATTTTG
CACAGCGTCCAGAGACCGGGATCCATATGGCCCCCCTCCACGCAGAGATTCTCTTATGTC
ACGGCGGGATGATGGTCCTCCACATCGAGATGACCACTATGGTAGTAAAGACAGGTGAGA
TGTTTAAAAGCCCAACCTTATTCGTTGCTAAAGACTGTGTAATGCCAGCGCCAGACATCA
TATCGCCTAATTCATATCCAAAAAATTTGAGTGTAGCAATTAATGATGGCCTTTTTGTGT
TCCTCCTCGACTTGAATTGTTTACTTGCTACGTCACTTCATTTGACACTAGCACTCTTAT
TTATTGCTGAATAACCATTCGGAGCACTCTTCAGCCAGTGCTGAATCAGGTCAATGAGAG
CTGATGTGTGGAACATGCCAAACCAACTAGTCTGACTAAAAAACCTAATAGTTGACCGTC
TGCTTGTTGTGTCCTGGCATTAAGGTTGTCATTTGGATCCACAAAAATGACACTTCTGTA
TTATTCTGTCCAGTCTAGTAGTTGGCCATATCACTTGGTGTATTTCTTAATTTAAAACCG
TAACCAATTGATTAAAGATGGTGAGCCATTCTGAAAGTAATATAAACTTGTTGCAGCCCA
AGTGGACCCTGCTTTGAAATTTGTATTTGTAAGCTGTGATGAATTCTTGTGGTGGTGATC
TACTTGAACTGATCTAGTCCACAATTGTCCTCTAAGAAGTTCTGAGCTTACGTTTTGAAT
GTTAATGCTTGTCCATCTTCTGACAACAATTTCAGACCCACCAAACTTATTAAAATCGCT
ATGTGCTCAACTTTAGCTTAAGCATTTTCTGGCCCGTAAATGTTGTGTAGTTGGTCTGAA
AGGTTAACATTCCCGTTATTATATATCTGACACTCACTCACATGTTCGTGTTTTGCAGTT
ATTCCAGCCGTGACTACATGAGCTCACGGGACAGCAGAGACTATGGCCCACCTCCACGAG
ATTATCCATACCGGGAGTATTCAGGCCATTCCAGTTCCAGAGATGACTATGGGTCAGGAT
CAAGAGGCTATAGGTGTGTACAGGTCCTAACGCATTTCTTTTATTGGCACTTAGAGAATC
CTATAGAAAACCTTTTTTTACTTTTTTTCCCTCTCAGTGATCGTGATGGCTATGGTGGAG
GACGAGAGCCCCGGGGTTATATAGATCGACCCAGTGCAGGCTCCTATAGAGATCCTTATG
ATGGTTACGGTAAGATTAAACCTGTAATGTAGTGAAAATGGTTTGAAGGGCTTTATTCAA
ACTGCCTGATTTGCAAAAAGAGCAGCCTCGTGATTTTGCCAGAAAGTGGAAAACTCAAAC
TCTGCGTCTGTTCAACCTGAATGTTCCAACCAAAATCGCACCACCAAGGAATCTCTTGCA
AGCCGTTTTTACCACCCAAAGAGTCTTTTCTGTAGCATCGTCCAAACAATCGAGAGATCC
AGTACCCAAACTACAATCTGGAGTTCAATCCAAACCAAGGAAAGTGTGTTACACTCCAGT
GAGGTGCTTAAAAAAAAAAAAAAAAAACTGTGCGCAAATGTCAACTCTGCAGTTGGGTAT
TTCAGTTATCTTAAAGTAGTTCCACCTAAAAATACAAACAAAAAACTAATTTATTGCTTT
TTGCTTTTGGAAACATTTGATCTACAAATGATTAAAGAAATCTAGGGAAATGGGCAATTG
ACAACATAGTATCATGCAAAAAAATGTTTAAGTAAATTTTTGCCAATTACATGACCCATT
GACCCTGCAGGTAACTCACGCAGCGCCCCACCCTCAAGGGGTCCCCCTCCGTCCTACAGT
GGGAGTGGCGGAAGCAGTCGTTATGACGACTATGGCAGCAGTTCCCGGGATGGATATGGC
AGTCGTGACAGTTATCCCAGCAGTCGGAGTGACCCGTACTCCACTAATCGTGGTGACCGA
CCGGGTAGGCAGGAGCGAGGGCCTCCCCCACTCGAAAGAGGCTATCCTCGTGAATACAGC
AGCTCAAGCCGTGGGGCACCTCGTGGGGGTGGACGCGGTGGCCGCCGACCTGATAGAGGA
ATGGGCCGAAACCGATACTGAAATGGACTGTGGAGATGAAAAATGAGTCGGAGAAATGAA
ATGGTGGCTTCTCGTTCAAAAGACTTTGAGCTTCAAAAGCGTTCTTTTAAACACTGAACT
TCAAGCTTCCGTTTCAAGCTGTACCCAAACTTGTGACGTTTTTTTTATTTTGTAATTTTT
AAATGCAAAGTTCTTTTCTCTACCCAGCTCACATTTACTGGTACCGTTGCAAATCTTAAG
TGTGTTCTTTGTTTTCTAGTGATTTGTAAAACCTGCAATGCCGTAACGTTGGCTTTCATT
TACCAATAAAGTGTTTTTAATCAAAATTTAATCCGCACTATTCAAGAGAATGAGAAACTA
TGAAGCATAAATATCCATTCGCCTCTAAAGCTTTCCATGGTGAGCACCCCCAAATGCCTC
GTAATATAGATTTAATGCAGAATATTTATGTAGGCATGATTGTTCACACATTGTTGGGGA
CTGGACAAATGTCAACTTTTTTGCAAACTCTCTATGGGTGTAGTTTTCCTCAGTGCAAAT
GGATCCTTCATCACAAAGCCTAAACATTGACGCCTTGCATCGACCAATCGAAAGACAACC
AAAATGCAGGAAACAATTCAGCACCACAGATAAAACCTGTCAACAGCTGGTAAGCAAAGC
AAACCCTTTTGTTCTGGTATAAGTCAAGTCTCGGTGGTGTTATTTTGCAACCTGAAGGTT
AGTGTAATTTAGTCAAACACCGTCTTGTTTGGCCTGGCTTATTCAAATGCAGTCTGAAAC
TCAATGTTATTTTCTACATTTATTAGCAAAAGCCCCTGCCTTCAAAGGAGTCTAAGATCT
CTTCCCAACTTCTGGATCACTGAGTTTAGGAGGCCTTTGTCTCTCAAAAATCAGCCGGTT
CTACTGTTGCACTAAAGGAGAATGTCTGGATTTTTTTTCACCCCCTTTCAAATGAAAAAA
AAATGTTTTTAAGTGATATTAAGATGAATCTCCTCAGTGGATCTATACCTACAACCAAAT
GTAAGCTGCAGAACCTCTTGAAACCTCTCAGTGGAAAAATATAGAAAATTCACTTAGTGT
TAACAAAAATCCAAAACCACTCGCAAGCATGCTGAATCTAACAAAGGAGACCACCTGGAG
AAAGACAACCCCATCAACAAACCTGGAAAAAAAACATTCAGATTGGGTCATTGAGTTCTT
TTTTTGTCAAATTTAATTATAAATAATGTCCCTTATGATGAGCTACAACAGCTTTCTGAT
TGCAAGTCTCTTTTTCCAGGATAAATGGAGGAAAAACTGCTTTGACGGTAATACTTCATT
GCTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 2275..2407, 2543..2649, 3070..3229, 3404..3505, 3605..3713, 4498..4632, 4717..4808, 5350..5965
2299..2407, 2543..2649, 3070..3229, 3404..3505, 3605..3713, 4498..4632, 4717..4808, 5350..5660
NC_007125.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved