Danio_rerio Locus si:dkey-102m7.3
snOPY snoRNA Orthological Gene Database
Danio_rerio si:dkey-102m7.3
Danio_rerio
si:dkey-102m7.3
14
SNORA74, snoU109, snoU109
1601..1798, 4590..4727, 11950..12105
3647
AGGAAATGAGAGGTTAATATAAACATAAAAACGAACAGGTCTATTAAATACAAAGCAAT
AAGCATAAATTCTAGGAGTTAAACATCACTCTTTAGGCTAATACTTCTTGTTTGAATATG
CTAAAAAGGGTTTGCATATATGTACATTTATAGATATAAAATTTCCCATGTAAAAAGCAA
AACAAGGTGTTTTGATTAGGTCTTAATAAATGACATTATTTTGGATGATGAATGAATTTT
CAAAAAAGCATTTTAATCCAAAAAGATTGTGTTGAAAAGAACAAAAGGTAAAATAAGTGA
GCGATGTAGAAGTTTCCCAGAAAGAGCAGGTAGCCTTTAAACTGCTAGACAGAAAATAAA
ATATATATTTATATTATAATAATAAAGCCATTTTATAATTATTTAATAAAATAGTTCTTT
ACTTTAATTTGTTAAGAGAGCTTTAGGGGGGCAGGATCAATGATGATGATTATTTTATTT
CAAGTCTGTAAGACTTATTTGAGTTCATATTTAGGTTATTCACTAAAATATACACTAAAA
TATATCATTTAAATCGTTCATAGAGATGAATGCAGTAAATAGTCTGTATAAAAAAGTTAA
AAAATAAACCTGTGCAAACAAGCTAACCTTTATAACCAGATTATTTAACAAAAGATGATA
CTGCAGTAAAATATTTGTAGTCTTTTAATAAGCAAGATGTGTACAGGATAGAGAGGGTGT
GAAAAGTGAAATGTTTGTTTTGAAACTTTTGAATCGGAATTTGTCCAATTATAAACCCGA
AATACACGTGTTTGTTGTCATGTGGTGAACTTGGCCAATCGTGTAATATCGGTGTCGTCA
TCAAAGCTCCTGCAGTCGCTCTTCAGAAGCTGCATGGTCTGAGTTTGCCGTCTGATCTCG
GAGCGCTGTCGCGGTACTTTGATGCCACATGTGACAGTCACGTGGCGTCGGCGCAGCATC
AATCCGGACAAGATTTCTAACCAGAATGCACCGCTTTAAGACAGATTTCGATCGATCTGC
GCAGCGCTGCATGAAGTCGAACGCACCTTCAGTTCACTCGTAAATAGGATGTGGCCACAT
GATGTCACCACGATCACTCTTCTTCGATGGTATGCAGTTGTAGCTATAAAAGCGTAGTGC
CCCCTCCTAAGATCCCTCATTTCGCGATGCCTACTTCGACGATGTGTGGAAGAAATGAGC
ATAAGAAAACCGAAAGGTTACAAGAAGGTAAAGTTTATCATTTTGATTTATCGCACACAC
TGTAGGGACGTATAAGCTTCTGAAAGGTAGTTAAATTGATGAGGGCTGTTTGTAAATCCT
GTGGGTCAAATGTGTGCATGTTGCATTCGACACGTGGTTTTCTTCTGAGTAACGTGGCTG
GTTCTTTGAAGACTTGATTATTTAAACAGGAACATGCCCTAAATGTATATTAATTTTTGC
TTGATAACTGTATAGTGAACTTTATTTAAAAATGCTATTTTTAAAGGCAGTTTGATATTT
TTTCCCCATTTTAGGTGGCTGACTGGTTTGTGTTTATAACCTGATGAAGACCCTTTGGCT
GCTGTAATGCAAGTATGTTATTTTTTTCTTGTGTATTAAAGCCCAGCGGTAGTCAGCTGT
GCAGGCCAGACCATGCCTGAGCTAGTGTTACTCTGCTGGAAGAGAAAGGCACTGCCATTT
GTGCTCCATCAGGTTTGGCTGTTTTAGTGAATCCTGCTGTGTGGTGCTGGTTATGCCATG
TCTTCTGAGAGTGGCCTGTACTCACAAAATGAGGCAGGCCTAGTCTGGAGGCAAACACTC
AAGTCAATTGGCTACTGGTGCTGCATATTTGTTTCCATGTTCCTGATGAAGATTGTTTTT
CCAGGTTGCACAAGACTCATCTAGAGTACCTCAATCTAGTGGTCTAGTGAATTGAGAGGT
AAGTGTTTCTCAATCCAGAAATCAAAAACTGTCAACTTTCTTTGTCTTAAGTGGTTAAAA
ATAAAATCATTCCATCAGGTCAGGGTGTGCATTTACTACAGGAAGAGCCATGTTGACCTG
CTTTAAGTTAGTGTTATGTGTGTACTAATAGTAGGCAATACAGCTCCTAGTAATAAAAAT
GGTGTAGTGCATTGGCTGTAGTAAATGCAGATCTGATTCAAAAGTAGGAAAACAACACAT
TTACCTTGTGGCTATCAATGTTGATTTTGTTTTTAAAGTGGCTTTTTCTATAGGAAGAGG
GTGTTGACTGTACTGTAAGAAGAGGTGAAATCCCTGTAAAAATCCTAGCGCAGGTAACTT
TTTCAGTCATTGTGATCCAAGATGATACCATCATAGCAGAAGCCTTTCTCTGTTGTGATG
TCTTTTTAATCTTGGAATATCAAATGCAGGGTTGGCACTGATTTTTGTTGCAATTTTCTT
CAAAAATCTGACAAAGAAGCCTGCTACATTTCATTATTTAGTATTTAATGTTGAGATCTG
TGTTTGACTTTTTTTTTTTTTTTTTTCCTGTGGTTGTAGGAAAAAAGTGTTGAAGATCAG
CCAGAATGACGATTCTCAAACGGTTCAATGTGAATGTAACAAGCGAAACTTCGACTGTGG
TGTCAACTTATCTGAATGGAATATGAATGTTCTTGTTTAATTTTTAGTAAATGAATATAA
AGACCTGCTCCCTTTTGTGAAGTGGTTTCATGCTGAATATTAAGAATTATCAATGTGTAA
TGCAATCAATTATGGCTGGTTTTCCATTTAGAAATAGAATAGTCTTATACAGGTTACTGA
AAGAATATTTTAAATTGTCAACTGCTTGGACTAGTCTTTTTTGACTTTACACTATTGACC
TGGTGTTATTTTATTTATTATTATTATATCTTACACTAAAATAATAAAGGTGTCAACTGA
ATTTTCAGTTGGGTAAACTATCTAAGCCAGGAGTGTCTGGACTCTGTCCTAGAGGGCCAG
TGTCCTGCATATTTCGAACCCCAATTAAACACCTAAACCAACTAATTAAGCTCTTTTTGG
GTGTTCTAGAAACTTTCAGGCAGGTGTGTGTGTCAAAGGAAGTTGGAGCTAAACTGCAGG
ACACTGCCCTCCAGGAAAGAGTTTAGATACCCCTGGTCTAAGCCATAGGTCTCAAACTCA
ATTACTGGAGAGTTGCAGCTCAGTTATGCTCAAACCCTAATCAATATGTCTGATCCAACT
AATCAGTGTGTTCAAAGCTACTTGACACCAATTGAATCTCCTAAATTTGTTTGATCAGCT
GTGTCTTGGGGTTTGTGCAAAAAACTGTAGAGCTATGGCCTTCCAGCAGTTGAGTTAAAA
GTCACGTCTCGCTAACAGTTTCAGGCTTTGGCGCATTTTGCACTCGCACACAAGCGTACC
GTGCCAAAGCCCAAGTGAACCGTGCTTAGGCACACCTCTTCCAACCGGGCCAGGGCTGGC
CAAGTAAACCGTGCTTGAGCCCGATTCAGCGCACTCACTTTTCAAACGATCCGGGAAACG
GGCCTGAGCACGGTACGGATGGCATAGTGTGAGTAGGCCCTTAAAGACCTATGGTCTAAG
CCACAGGTGTCAAACTTGGTTCCTGTAGGGCTGAAGCTCTGCACAGTTTAGTTCCAATGC
TAAAACACCTGATCAAACAGTTCTTTAGCATTGTTTGAAACCTACATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1226, 1514..1571, 1864..1917, 2198..2272, 2499..2647
NC_007125.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved