Danio_rerio Locus rsl1d1
snOPY snoRNA Orthological Gene Database
Danio_rerio rsl1d1
Danio_rerio
rsl1d1
12
SNORA55, SNORA55
1797..1926, 4514..4644
11339
GAAAGGGGTCCATACAGGGTCTAAGCTTGCCGGTACCCTTAATCTTTACCTGGCAAGTC
TTGCAAAGGTCAAAGTTTTCAAGATTAGGTCAAACAAGAGGCCTTGGTCCTTCAAATCAA
ATGACATTTATGTAGAGATGTAATCATGCACAAGATGAACAGATGAGTTTGTTTACTGTG
TCATTACATAGCAAATGACAAATGCACCCATATGGTAAAAAAAACACTTGTCTCGTCAGC
TGGTGTAAATTCTGTACACTCCTGTTGGGGATGTAAGCATCAAACTTCCAAAAATAAAAT
GCTAAAAGGACTTTAAATGAAAATGGACCTTTGTTTTATCTTTGGAATTCAGATTGTAGT
TTAGCAATTCTGTTTTGGTTAATCTGCTAACGCTCAATGATGTTTAGCTAAAGCTGGAAG
GCCAAATTGTAATGACTAATGCAGAGACTAATGTTTTCAAATTAATGTATTTGTACATTT
ACAAAGGTCTGCAAGAAATTAAAACATGAATCTGTTTCCTAATAAGTGGAATCATATATA
TTCATTTTATATTAGCATAAATATACTATAAATATGATATAAAATAGAATAAAGGTATAA
TATCATAATAAATAAGTCAATTGTTAGGTATGGGGAAGCTTATTTGATCTGGAGTAGCTT
TGGACTAGATTTAAAACAGAAGCATGTTACTCTGTCAATGGGTTTTCTCAATCAGCTGCC
CTGCGCCCACTAGGGGTCTCAAGACGACATGAGGTAAACAATTCACAATTCATATACAAT
TCATGCTTTAAAGTAGCCTAAAACATAAATATTTTCTTTATTTTGCTATATATACTGTAC
TTTACTATCTATTATTCAGTAAAATGTTTTGGGGTAACAATGTTAAAATCATAGACTAAA
AAACAAATAAATAAAACTAACGTCAGTGAAACACTGAAGCCAGAAAAAGCATCTCGTTTC
CTAATCCTGTTTCAAAATAAAAGTCTCTGACGTTTACCTTAGATCTGCGCATGCTCTTTT
TGCTCTTTCGCCACACGTGCAGCATGGAGACCCCACGAGATGAGTTGACTATCGATCAGT
CTCAGGTAAATGAACAGTATTTAAGCGTTTTCCAGCATATTTTTTAGTTTAATAATGGTA
ACGGTATTAATATCTGTATGTTTGTGATTTGATCGCCATCTTTTAAGAACTCGTATTAAG
CAAAGCTGCAAGTCGGCTAACTTTAGCTAGCGAAGCAACTGAATCCAAAGTCTCTAATAA
TAGTTAAACGCTAACGTTATCACAAAAATCACAGGTAGTATGTTGGCCATGATGACTTAT
TTTAAGTTTGTGTGCAGTAGTTACGTTGTTTAAAGCCGCTGTCTAACTGTTACAACTGAT
CAAAATCTTTTAATTTCGTTACTAATGTGTATCACAGGTGAAAAAAGCAGCACAGGCATT
ACAGGCGTTTATAAAAAACAGCACATCGTCCCAGAAACTCTTCCAGAATGACGGTCAGCC
CATCTCTCTACTTTTTACCTTATGGAAGATTCCTAAAAAGGAGCAAACCATTCGCATGTG
AGTATTTCAGTGGCAAATCAATTTAGAGATTCTGTTTTTGGTTTTACAAACTGTGTTTTA
CCCCACAGTCCGTTATCTCATGGACTGAGGACAGAATCTGGAGACGTGTGTCTTTTCACC
AGAGATGAACCCAACATGACTGCAGAACAGACAGAGAGATTCTACAAGAAGTTACTCACA
GAGAGAGGGGTCAAAAATGTCACAGAGGTATTTCATCGTACTTTACAACATTTATCTGCA
CTTCTGCAAACCCTGTCCTTCTGTGTCAGTGCTGGGCACGGGTTTAAAAGTGCTAAAGTA
CCTCAGAGTGCATCCAGACAAGTCTCCTCTTCTATTGGCGCTTGTCTCTACAAACTTTGA
AACAAGCTAAACTTTCCGAGCATGTGCATTTTATGACATTGAAGATCATGTATATGTTTT
AATATTAATATTATATTTTCTGTTATTAGGTGATTCCCTTCAAGGCATTGAGGACCGAGT
ATAAGCCATTTGAAGCAAAGAGAAAACTGCTTGGCAACTTTGATTTGTTCCTGTCAGACG
CACGCATTCGGTTCAGGTTACCTTCCCAAATTGGGAAACATTTCTATGAAAGGAAAAAGT
AAGTTTATTTAAGTAAGAATACTTCAAAGCAATTTTTGTTTTATGTCATTACAATGATGC
GGTTAAAATTTTAATTTTGCCATAAGTTACTTAAATGCTTAGTTTTACAATCGGGCTGTA
GAATTTCAATTTTGCATCGGCAAAAATGCTATGAAGTAAAAAGGGATGTTGAACGATGTA
CAAATGCATGTTCTTAAAGTTTTTTTTGTTTAATTTTTTTTTTTTTACTTTGCCTACTGA
AGTTATTGTGTCTGCTTTCCAAAAAATCTTAAATGATTTTATTGTCAAGACACCTTTACA
GCAATCTGAAAGTGGGCAGTTTTTGCTTGATGTTTTTGCATGGTCAGAATGTTGAGACTG
TTGAAAATTGTGTATTGGAAATAATTACTGTAGGTGTTGTGTTAGAGATCATGAGCTATA
TACGTATAGACACACACACACACATTGTGATGTGAATCGAGCACTCAAGGCTTGTAAATA
ATTACCCCCTGTACTATGAAAATAAGTAATAATTCTTTATTTTCTTTTTAAAACGTCTGT
CTTAATTTACTGTTTGATCACGAAAGACATTGTTTATATATATATATTATTTATGTAAGA
AATACACAATCTACTATTGAGTAAATGAACACTAAAATGTTTTGTTATTAAAGGTGCACT
AGGTGATCTGCCAAGATGCTAACCGGTTAGAATATTATCTTTGGAGGGCAGAGGAGGGAC
TGTGTTTCAAAGCCACGTCTCCTGAAATTGTGAACACGTGTACCGCGACATGACAGCAGA
CAACCCAATAGTTCATGTCATTCACCAGTTAGAAATGAAGTTAGTGGTTGGCTGGCGGCG
TGCAGGAATTTCACATTACTAACGCCCCATTCCATTATTTCATTGGCTGTAACGATCGCG
TCAGCCCCAACTTCAGACACACCCTGTGTCAAGCGTTGACGCTAAAGCCCTGTGTGAATC
CACACTTGCGTGCTATTTCAGAGCGAATATTCAGAGTAGCATAGTAAACTGTATAGGAGG
GCTGTCATTTAAAAATGATCCAATGTGAATATAAAACCAACTTGACCTCAGTAAAGCAGG
CTAGGCGGAATAGAGCAGTTTACTGATGTTTTGTTGTTAAACGAAATAAAAATCTACATA
ATTGATGCTGTAAAAGGCCCTGAAGAAACTGAAAATAGTCACATCAATCTTTCAGTGTTA
CTTTTCGGTGGCTGAACAACATTTCTGTGCATATAACCCATTCACAACAATACAATCTAC
ATCAGCTTTAAGGGTCTCAAAGAGTTTAAAACATACCATTACTTGTCTAACAGAAATACT
TCAGCCATGGTGTCGTCCTTCCTCCAGCGTGCAAAAGTAACTCCAATATTGATTCAGGAT
TTTAAAAAGTTTTAATTCAGCATTTGATTTTACTGTGAATGGAAGGTGTGAATGTGCAGT
GCGCTTGTCGGCATGCATGCGCTAATGGCAGATCTGCGTGAACGGATGCGTAGAAGTCCA
AATCTACATTTGTTGACAGACATTTTGAGCTACTAATCAGAATTATGAAAGATGTCAGCC
CGACAACATTTAATTGGATGAACATTTGTTTTAGTCTTTTGTTTTACCCAGAATATAAAA
ATACATATAAATACATTTAGATTAATTACTTTAATCATTAATATTGGAATGTGAAGAGAC
TTTTAACCAGCACAACAAAAATGTTTACTACTGCATCTTTACCATTGAAAGTCCAACATA
ATTAAACTGCGGCAGTAAAATAACTAAATGGAATAGTAGCTAACTATGTGAAATTGACAC
ACTGTGTTTTATTTAAAGTCAAATCCAATAAATGAACACTGTTTTATTGATGGAATTTGG
TAAAATATTTTATTATGCCTTACTGTGTTTCAACCATATGTAAGCGTACAAGAAAAGTCA
CTGACAGTAAACTACTACATTACAAGTATAGAATAGAAGTAGGTGATCATCAGTGGTCTT
TCATGGCACTATTACATAATGAAACGACTATCCATAATGGGTCTCTTTGCTTTTAATAAA
ACCGTTTTCTGCTTTATATGTAGAATATATATACACGTAATGTATAAAACAAATCTGTAA
TTAGTCTCTTATAATAAAATCTCTTCCACTTGTGATCACATCGGTGAAAACGCATGGTAA
TACCAGGTGAAAGCAAAGAGTGAGAGAGTTTGAAATGTTTTCTCTTTCTCAGGGCTCCTT
TGTCAGTGGATCTAGAGAGTAAACATCTGGCCAGAGACATGGAGCGCCTCATTCAGGGCA
CAACTCTCACCGTCTCAACTAAAGGCCCTTGCTGGTATGATCATTGCTTATTTTCTGTGT
TCTAGTAGGCAGAAGCACTACAGCAAACCATTTCCTGCTTCTTCACAGCTGGATATGGGT
TAAAACTGTGCAATAGTAACTCATAGTGTATCCAGATGAGTCTCCTCTTCTGTTGGAACT
TGTCTCTACAAACTATGATACATGAGAATTGTCATTTGTTTTTACTTTTAAATGTTTTTA
TGTGTTTGACTGATTAGTTTGTTTGTTTGTTTTTTCTATTATTTGCAGCATGGCCCGTGT
GGCACATTCAGAAATGACAGCAGATCAGATTGTTGAGAATGTGATCTCAGCCGTTTCCAC
AATTTCAGCAAAGTTAGCATCAGTGAGTAAAAAGGGTTCTGAGAGATTCATCAACTGTGG
TTAAAGCAATTTTTACACCCTCATTGTGGTGTAAATCTGATAAAAAAATTCCTAGAATTA
AAAACAAAAATTTAATGATTTTGTTCTTTGGGAAGAGATTAGATCACTGGAATATGGCCG
TTGTTAACAAAATTAAGGATGATAGCCCCTCCTAAAAGGCATTCCAGTGATCAGAAGGGA
GCAAAATAGTCATTTTGAGGGGAGAGGCATGGTTATTGTGGTATTTGATAAAAGATTATA
ACGGCAAATTCATTTTTACAAAATAATAAAATGCACCGATACATAATTTGTATCTAGCAC
TACTAAATACCTATAAAATTATGTAAATTTAGATTTTTGTTTAAACGATGTGGGCACTGG
TGTAATGACAGTCACTTAAGAAACAAACTTAAAGGTGTAAAGCTTAAAAGCATTCACTGC
ACTACAGAGCCTTTGTGAATATAGCTCTGTTTTTTTATACTTAAAGCACAAATATTTCTT
TTGCAGATGTTTTGTAGCTCTTTTTTTATAAAATGATTTATTTAAATATTGTCACATTTT
ATTAAATATTAGAACTCTGATGAACATGTAATGTATTGGTTCATATAAAACAACTTAACA
AACATTAAGTTAATAATAAAGTTGTATTTAAGACACTGTATTTTCTTTTCGTTTTTTTTT
GGCCAATGTAAATTGTTCCAGACAAAGCCTGAGCAGACCATTTGTGAGTTTCAGTACAAC
ATTGAAATGTTTTGTTTCTGAATTAAACGGTCCATAAATCATTGATCTATTTATAAAAAC
AAGCACTTCGGTTGAATCTGAAATCGCACCACATATTTAGCATTTTTGGTTTAAGGGACA
GATCACTCAAAGATAAAAAAACCTCAGTTTACTCACCTTCATGTGGTTTTAAACCTTTGA
ATTGGTTTCTTCTGTTGAATGGAAAAGATGTTTTAAAAAATTCTGGTTAATTCTACCAAT
TGATTTCAGATGTAAATTGTAATAAGATACATTTTAATTACATCAATATGTTTTGTGCAC
CTTTTTTTCCATTGGTTAGCGTTTTATTTATAAATTGGTGTCTTCTTGTGGCTTAATTTG
ACCTTTTAATCAACCTTTAATCTGTTTCTTCTCAGACAGGAAAAAACATAAAAATCATCC
ATTTGAAGAGTCAGACATCAGTAGCGCTACCCATCTACACCTCTGATCTGAGTCATCTCG
CGTTGGTGGAGGAGGCCCAGAAGAAAGCCCGTTTAACAAAGGTGAGCTTGCTGAAGAAAG
GCAAAACTGATGAGGCCAAAAAAGATTTGTTTTTGTCAAATTAAGTGATTACTTTTGCTA
TTTAATTATTTAGGGAGCGCAAAAGAGGAAGAGAAAAACTGAAAATACAGAAGCGCCCAA
ACCAGTAACTAAAGAGACTGAGGAAGAGAAAGACAGCGAAGAGGAAATACCACAGCTGGT
GCCAATCGAGACGCCAAAGAAAAAGACAAAACGGGAGGTCAGTGTCTGCACAGCTTAGGA
GGGAGAGTGCCTATAAACACAATATTGATGCTGCATTGTGTTCGGATGCGTTCACAATTG
GCAGGTTTGGTTTGACTAAAAGAACATTTGGTGCAATTCTTTTTAGAAACTTGTCACTTT
TTTTTTTATATATACCTCGCTTACATTTTTTACTGGATGTTGACAATTGAGATGTATTCT
GCCACAAAACCCGTAGAGCGGTTGGCAACGCTGCAATGCCACCGCTCTGGGCCGTGTCAG
ATTTACAGCTGAGCATACCTGTTTTAACCTAACTAAAAATGTGGGAAAGAATACATTCTA
ATAATAGCCTTTGTGTTTGTGATTTTAGCACAGTAATTCAGTTCTGCAAACACTCTGAAA
CATATGTTGATGCAAGCCTGTAGAATTGGCATAGACGGAGGGGACGTGTCCCTACCAATA
ATTTAATCGACTTCAGAATAAAATAATGCTCCGTCAACTCCTAGTAACCTACACGTGCAC
AAAGTCAAGTTCACTGTAATACTATTAACCAAGGCTCTGCAATTAATCGAAATTCGGTTT
CAATTTTGGCCTCCATGATTATGAAAAACAATAATCCAGATAAAAGTTACATTGCATCAC
ATACCTCAGTAAATCTTCGACATTCATACTTCCTCAAAGCCTGACTGCAATAAAATCATG
TAAATGTACTTTTGCAGCATGAGACGTAAGTGTTAATTGTATTATTAAGTGTTAATTTAA
TATTTAGTACTTCATTCTTGTTTTGAAAGTGCGAAAGGGATGTTCATCACATGTGCACTA
GGGATGTATGTCCCCACCAATGTTGAGCAAATCTACACCCTTTGTCAACTTCTTGCCTTG
GCTACTTTTACTGCGATTGGTTGCCTTTTAACATTTTGCATCAAGTCAGGAAACCTTTCT
AATGCATTGGGCTACTCAATGTGCATTGTCCTGCCTCTTTCAATCCCATTAAGCATTGCA
TGGGCGATTACAGTCAACTTTAATATGAATGAACTGAAAATACTCCATCGCGCTCCATAT
GTACCAGTGGAAACATGACGTTAAAGTAATAGTTCATCGGGGACAAAGCATCTCACCCCA
TACAAAAAAAGGTCCTTAACTATTTTGCATTTCTTTCCACTGTTGAAAGCAAATCAAGAT
ATTCTGAAGAATGTTGAAAACTGGCAGCCATTGACTTCCATAGTATTTTTAGTTTCTATT
ATAAAAGTCGATGGCTGCTTTTTTTAAATCTCTTCCTTTTGGGTTTAACTGAATAAGGAA
ACTCACAAGATTGAAACAAGCGGAGAATAAGATGATTAAAAGAATAAGATGGTTATACCA
AGGTGCAAATTCCAGGGGTGTTCAGGGGGGATTGACCTACTCTAATGGCCCGTTTCCACT
GAGTGGTACGGTTTGGTTTGGTACGCTTTTATGGCCGTTTCCACTGTCAAAAGGCGTACC
GAACCAAACCGTACCACTTTTTCGGGACCCTTTCGAAAGGTCCCAAAAGGTGGAGCTACA
CGCGAAGCTGAACGCTATTGGTTTATAGAGATACGTCATTCGTAGACTCATCAAGCCAGA
ATGTAAACAAAGGACCCGCCATGTTTGAAATACACAGCGAGAGATTACAGCGGAATTATA
AATACATATGCAGCCATGGTCGATCCTGCAAACAAACCATGTCGTTGTCATGATAAACAG
CCACAAAGCCATGGAGGAGAGCAGATTCACCCTGTGCCGCGTAGTTTTTAACTACTAGCC
AGAGCCAGTCTGAAGCCCGATTGGTTTCGCTTTCTTTCTTGCGCTCGCTGCGCGTCTCTA
TCTGAAATAACAAACTTCTTGATCTGATGATAATAACATGCACTTGATTATTGACAAGCT
TTGGAAACCCGATCCTGTGAGAAGCTGACAAACGCGAGAGTGACACATTCAGAAAGAAAA
GGACAAACGCAAGAGTGGAGCGCGGGAAAAAAGGCTAAGCCAAGTAGCACGTTATTTCTT
CAGCAAACGTGAACAAACTGCCTTGTTTTAATCTTTATTATCACCTTTTGGACTAATATG
AACTGGGAATGATGGAATGACTCTCTAACAGAGGCTTCATGTGCTGCTGAAGATTACAGA
CACAGATGAGAGGTTTTCACTGACTGTAGGCTATACTTTGTATTGTTTTGAACCTAATTA
ACAACGAAATGACTGCTTTGAGTAGTTCTTCTGTAGTTGGTAACATATCGGAGACTGTAA
AGGTCTGTATGTGTTCATATATGTTTATTTATTTATTTAATATAATTATAGACGTTACAG
TAGGCTATTTCGCACTGTCATTGATCTGCAGTTATAATCAACTCCTGTTTATAGAAAAGT
TAGTAATAAACATTTATACACAAGTATGTATGTGTAAAGCATCTGTTTTGTGAGAAGTGC
TGTTCATATGATATGTGAACGACCTGTGCAGCTTTATTGTAGACATTTTCTCGAGCGAAA
ATGACGTCGACTGAAACTTGGTCATACACCACGCCCACCAAAAGGGTACCGTTGGTAGTG
GAAACGCAAGCCTGATAAAGGTGACCCGTACCGTACTGTACCAGTCAGTGGAAACGAGCC
ATAATTAACACTTGATCCCCCTGAATTCTAAACATAGGGTATGTGCGGGGTCTCAAAGTC
TTATGTCTTGAATCTCAAAGCTAAATTTTAGGCCTTAAAGTCTTAAATCTACTGAATTAT
TGTGTTGTAGATCTTAAATATTTTTTATAATAGGTCTTAATTTTCCCTTGTTCATATAAA
GCTGCCCAATCTGGCCATGAACACCCATACAATCATCAACAATCCATCTCTAAACTTTTA
ATATTTAAAAAAAAAAAAAAAAAAAACATTTAATTACTTCCCTTATAGTAACTTTTTGCT
ATTATTATTATTATTATTATTATTATTATTATTATTATTATCTTAGACTAAAGTAATTGA
CAGCTGTTTTGTTCTGTTATTGGTAAGGGTTATGGGGTTTGTTAATGGATATATTTGAAA
ATCAATTAAAAAAATATTCAAACAAAATTAATATTATTGAATTATTAAATAATAATTATC
ATTTTTTTGATAGAGCTAGTGAAAATCTTTTCTAACTGGGATGTTCAGAAAAAAATCCTT
AGCCCCGTTCAAGTCTAAAATTATATTCATAATAGTCTTAAAAGTGTCTTAAATTTTAAC
TTGGTGAAACCTGCAGAAACACTGAAACAAGACGTATGAGCGGGTCAGCCTCTAAATAGT
GAAAAATAGTTTTCCCTAATCTGTATCTGAAATAATAATAATTAAAACTAGATAATACAA
ATCTCCATTTGGCCACATATGATCCATTATAGGGGTTTATGCCTAATTACAACAATCAGT
CCTTGCAAGAATCATTTAACAATCTAAACCAGCAGATCTAGAGCGACGCATAGTTTGAGC
TACAGTAATCTGAAATAATCAGACGTTACTGTATGTCAGAATACATCATCCCACAAAACA
CTGAAAACTTAAATATGTCTTATTAATAAATTTGATCTCATATAAATAAATAAATAAATC
TGATATAGTCAACCAACCTGATCGCCAATGTAATTCTCACTCGGACTATAACTATATGGG
TAAACCATATCTTTTTTTATTTTTAATTTATTTTTTGATGTGATTTATTAATTTTGTTGT
GTTTTTTTTATTTTACAGGGCCTATCTAAAAAAGGACTGAAAAAAGTGCCCAAGCCTGCT
GCTGGCAACAGTGTGAAGAAATCTGTAAAGGACAAAAAACTTGTCAAGAAAACACCCAAA
CGCACAGAACGTGGTCTGGAAAAAAAAAAGCTAAAAACAAATAAAACCTGAAATGCAATT
ATCATGCAGCTTTCCCTCTGTTAACCATTTACATAGATGTATTATTAAACAATATTTCGT
ATCTCACAGTTGTCACAAGGTTCTTGTAAACCTTTTGTTCTGGTGAAATTAACAGTCAAT
TAAAAGAATTCAAAATCTGATGTTTTTTGTGATTCATTTACAGTGGGTCTGTTTGGGTTG
ATCAGTGTTCATGATAGTGTTGTTTACAGTTGTAGTGTCTGTGCGGTAGACATATTATAT
TACATGTATTTGTTGAGCTAGAGAGTGTGTTGGACCAGCTGCTCCTCTGTTTGTGCTGCT
GATCCTGCTCACTATGGTGTGTATTGCATGACTTTGCCCTGAGTTCTTCCATTTGGGTCT
GCATTGGTGATCTAGGCACAATGATATTTTTTTTCAAGATTGTTTGAAAGATCCTGTTTT
GCATGAGATGTTTATAATCGTCTTCTGAGAGAAGATTACTGTTTGGCTGTTTTAATGAAT
TCTGTGATGTGCTATTTGAATTGATCAAAGGAGAAGAATACAGATGATCTCTGAAACCAA
AGGCAAGTAGAAAACTGATTTTTAATGCTAATTAGTCTTTGGAACAGTGTTTAGGTTGTT
AAATTGTTAAACATACAGGTCTTACACTCAACCTTTTAAACTTATTTAATATAAGCTGAA
AAGTGTTGGTTCATTTTGGGGGCAAGTTAATTGTTTCATGCTCAATCCACCTTGATTTAT
AAAAAGTAATAAGTTAACTCAATTCCTTCTTGCTGTCCCAACACTAATTGATGTATTGTT
CAGTATGTTACCTGTTTATCAGGAAGGGAAAAGGGAACAAAGTGGTTGTTATAGGTGTTA
CAATATCTAATAACAATACATTTGATCGCATGTTTTCAATGACCCAATCCATTTTTTTTT
AAACAGCCGATGTTAAAGTTTTTTCAATCAAGACTTTAACACGAGTCTATACAGTGTGCA
TCTCCTTTACAATCTATGTAATGATCTCATATACTCCTATAGTGCAGGCAGTTTGAGTTG
TAAAGTACCTTATCCGCTTTTGTCCTTCAAAACTCGCTCATGGGCTTATAGTATTTGCTG
TAACACTTTACAATAACAGTACATGAATAATGATGTGTTAATATGTACACGATTATGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 1417..1556, 1628..1766, 2009..2157, 4372..4473, 4728..4821, 5975..6100, 6193..6336, 10038..10339
1010..1084, 1417..1556, 1628..1766, 2009..2157, 4372..4473, 4728..4821, 5975..6100, 6193..6336, 10038..10190
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved