Danio_rerio Locus nifk
snOPY snoRNA Orthological Gene Database
Danio_rerio nifk
Danio_rerio
nifk
9
ACA64, ACA64
2849..2975, 3666..3792
5483
ATTTATTAAAACATAATAAATAGTACAGCACAGCCTTAGTCAACTCTGTTGGGTAGATA
AGTAATTTATAACAAGTAAAATATTAAGATAATTAATAAGCTAACTGTAAACCCACTATT
TATTTGTTTGTTTGTTTGTTTGTTTGTTTAGTATTTAATAAATGTAATACAGTGTAAATA
TTTAATAAAACATAATAAATAGCATAGCACAACCTTAGTCAATGCCGTTGAGTAGATAAA
TTATAACAAGTAAAATATTAAGATAATTAATAAGCAAACAACGTAACCCCACTATTTATT
TGTTGTTTGTTTGTTTGTTTATTCATTCATTAATTTTTGGCTTAGTCCCTTTATTAATCT
GGGATCGCCACAACAGAATTAACCGCCTTATTTATTTGTTTATTTAGTATTTAACAAATT
TAATCCAGTGTAAATATTTATTAAAACATAATAAATAGCATAGCAAAACCTTAGTCAATA
AGCAAACTACGTAAATTCACTATTTATTTGTTTGTTTGTTTATTTATTTCTTTAGTATTT
AAGAAAGTTATACAGTGTAAATATTTAATAAAACATAAAAATAGCAAAGCACAACCTTAG
TCAACGCTGTTGATAAGTAATTTATAACACGTAAAATATTTTGATAATTAATAAGCAAAC
AACGCAAACCCACTATTGATTTGTTTGTTTGCTTATCTAGTATTAAAGAAATTTAAAAGC
ATGTAAATATTTATTAAAACACAATAAATAGTACAGCACAACCTTAGTCAACTCCGTTGG
GTAGATAGGTAATTTATAACAAGTAAAATATTAAGAAAAATAATAAACAAACGACGCACA
CTCAGTATTTATTAAGTATTAAAGAAACTTAAGGAAACTCAGACGTTTATTAAAACATAT
TACATAACATAGCACAACTGTCAACGCCGTGAGTTTAGTTGACTTTTATTTTGTAGCTTT
TGCAGGCTTTTATTTTGAATTGTCGCTTGCATTAGCAGTTTCCTGAACGAGGCACAACGT
GGTTTTAGGAGAAGCCATACGACAGTAGGTTCAAAACGTTTAGCTTTATTTATTTGACCA
CTGTTAGATTTCAATATGACAGAAGGCAAATCATCAGACAAGCCGGCGAAAAGACTGCTG
GCTCTGAATCCGAAAGAGGACGCAGAATTTCAGAAGAAAGTGCAGCAAGTGAAGAAGCGT
CCTCAAACGGTATGATGCGTGGCCATGTGGCCTTAGTTTAGCCTGACAGTGCTTCAGATT
CACATTTAAAACGTGGTTGGAACAAAATGTTTCTTTTAATCACTAATATGCTGTAGCTAG
AGTTAAGTTCGGTAAGATGAGTCTTGTTTACACTTGACGGTGCTAATGTAATGTTACTAT
TTGGTTTACGGTGCACATGTTACATTCAATATTTTGTTTTGCATTGAATGCGCTTCATAA
TTTGTTTTGGTCCTCTTTCAGGGTCAAACACTTAGTCCAGGAGTGCTGTATGTTGGTCAT
CTTCCTCGAGGACTGTTTGAGCCTCAGTTGAAATCTTACTTTGAGCAGTTTGGCAAAGTC
TTACGATTGAGAGTTTCCAGGAGTAAAAAGGTATGACGTGCATTTGATTTATTACCTTAG
TTTATAATGACATGACGTTAAATATAAAGTAAATTGCTCAATACAAATGGTCAAGACGTT
CTAACGCGGACTTTCTGAATCTAATACATGTTAAAATGTTAAAATCTTGCTTTATTTATT
AGATAAATTGTTTTATTTTGTGTTTGCCAGTACTAGTATATCTAAACATTTTTTAAAGGG
ATAGTTCACCAAAAAATTCTGCATCAATTACTCTTTCACTACTTTCTCCTCTGTTGAACA
CAAAAGGAAACAATTTGAAGAATGTTGGGAACTTAGCATGGAATCCCATAGTATGTTGTT
CCTGCTATAGATGGAGGTAAAGTTGGTTTTGTATTAGAATATTCAGACATTCTCCTTAAT
ATAATTTTAGAAAAGTATTCTTTGCAAATTTTAAATAGGAAAATCATATTAGCAGCAAAT
GACTAACAAAGTACAGCATTGTTCACAGCGAATTAGATAGTGTTGATGTTGTTTTGAAAT
CAAACATGCTAGTTCAGACTCGATATTCAACATAGCGTGGTAAACAATATAGAGACTGCT
AAATGAACAAATGTGCAAATATAAAACCAACTTTTCCTCCATCTACTATAGATGCCAGTG
GTGGCTGGGTTTTCAACAATCTGTAAAATGTCTTTTGATAAAGTCTTATGATTGAGTTTG
CAGGAGTAAGGTTTTAAGCATTTTGTTACATTGGTTTGCAATGACCTGATGTTAAATATG
AAGAAAGGTGGAAGAAGTGTGAGGTAAATGACAGAATTTAGATTAAACTTTTCATTTACG
TAGGGTTTATTGGCAGATATTTCGTTTAATAATAAATTAAATAACATTTGGCCAATTTCA
CAGGGAATTAAGCTTTCTTTACTTTTGTTTTACAAATAAAATCAGCAAAAGCCCTGTAAT
TTCCAAACAAACCAATAAGAATTCTACAAGGAATCCTATAAAGAAACGCATAAGATCCTC
TTGGATAAATACGTTTAATCCAATGAGGCCCAATTTGATTCTAAGAGGATTTTTAGAGAA
ATCTTATTTGATTCCCAGCGGGTTGCTTTCAGATAATCATCGGCTGCATCTGAATTGTAT
ACTCTAACCATTTCTCATTAACTTTATAGTAGAGAAGTGTGCTTTTTTCTTTATGTAGCT
GTAAACATTCTATCAGGATCTTGTGTTTTTTTTTTCTTTCTTTTTTTTCTCGTTTTTAAT
TTCTCTATATAACAACATGTTTAAAAGGCACAATCTGAAAATTACCTTTGGCATTTTGTT
GCGATGGGTAAGATTATTGTGCCAACATTAATTCGGTACATTTAGCTTATTGCCAACTTC
ATGTAGTTGTGCAATGAAACCCATGTGCCTACATTAATATCACAATAGTCATATTGGGTG
ATAATGCTTTGCTGGAGGTTTTACCTCATAAATGATTGAACTGTCATCTTTCACAGACTG
GTGGGAGCAAAGGCTATGGATTTGTGGAGTTTGAGTGTGATGAAGTGGCTAAGATTGTGG
CTGAAACCATGAACAACTACCTTATGGGAGAACGCATTATAAAATGTGAGATGAGAGCAT
ACAAGATTATTAATCATTATTTTTTTTGTCTGTGTGTGATGTTTTTTTATGAGTAATGCT
GTGTATTGTACTTTTCAGGTCACGTTATTCCACCTGAGAAGGTTCATGAAAAGCTCTTTG
TCGGCTCTATTGCTGGCTTCAAGAAGCCAAAGTATCCTGCAGTGACTCGGTATAACAAAA
CACACACAGAAGATGATGTGAAGAAAGTTGGCACAAAGCTTTTAAGCAAAGAGTCTAAGC
TGCGCAAGAGACTGGCAGCAAAAGGCATTGACTATGATTTCCCAGGATTTGTAAGTACTA
CAGTCAGAGTATGTTTTAGTTGGGACTTTTAAGATGTTATCATTAATTTGATCATGTTTT
TTTGTTTGCAGGCAGCACAGATTCCAGCTAAAAAGGCTCCATCAGAAGCAAATGTTTCAG
TGTGCAGTGAGGTTAGTCTAATCATTTTAATTCAGCTTAATTTTTTTACCACTTCTGTAT
CTTGGCATATACTGAAAATTATTTCAGTTGTAACCATCAACTGGAGTAAGATAACTGTGC
CGACAGAAAATGGTACATTTTAAGCTTATTGTCTGTCACTTTGACACGCAATGAAACCCA
TGTGCCAACAGTTACTGTAGTGTACTCTATTTTTTTTTATTTTGCACATGTTGTTAAGAT
GCATTTTTAGTGGATCTGATCACAAGGCTGATATCTGCTGTTTTTTTATTGTTGCATTCA
GGATGTAACTCCAGTGTGCACACCTTCACTTTTGGAGAGGAGAAAGTCTCTCAGAGTTGA
GGATGATGATGTTGATGATGAAATAGTCATCAAAGTCAAACCACTCCCAGAAAACAGTGA
TGATGTGGAAGAAAGTGAGGAAGAGTCTGCTGAAGAGGATGAAGGTGAAGAGGAGGAAGC
GGCTTAAAAGGAGAATTTAGTGACTAATAAAGACTTTATTCGCTGATTCAGAAGGGGACG
CTGGACTCGCTTTTCAGAGCCATTTGTATGCGATTAGTTCTCAGTTCTCCCCTAAGGCTG
GAGAAGAGGACCACACATATTACTCGCACACATTATCCTGATTGTCAGGAATCTGTTGAT
TTGAGGCGTGTTATGCAGAGTTTGTGCCCGTGACCTTTTAAGGGTACAGTGTGGTTGACC
ATAGAGTTGCTGAAATGACTGTATTAATCAAAGCAGATGTATAGTGTTAATATGAAAATA
ATTATTTTCATTGTATTTGACACAATTTCTGTCCACATATGTTGCATTGCAATGTTTGTA
AAACATGTTTAAACCGTAAAATAAACTGTTTTAATAATTGTAAAGCATAATTTACTGAAC
GCCAAATTCTGTAAAGTGCCTATGTAATGTTTGCATGAAAGCAAAGCAGTTTTGTGGAGA
AAATGGACATCATTGGAAAGAAATGCATGACTAAGAATAACCACTAGATGGAGCTAGGCT
TCGTTTTTCCACTGTGGTTTGGTCGTATGGCAAGCCGTTTTACATTATTTCCACATTATT
TCCACCTTACTGTAGAAGTTTGTATGGCTATATGCATGGCGCAGCGTCATTACTTCCAGT
GAAATACAAGGCTGCTGGCTTTTAGTTCTGCCCCTCGTACAGCACTGTGCTACTACTACA
AGATCACTGCTCACTAAAACGTCTAACGTTAAGGATAGTTGTGTTAGTGCTTTATGCTGT
TATAGACCACTTGTACCGTACGTTTTTGCCAACTACATAATTATGACGTTAAATGTTTGA
AGGAGATGTTTCACAGACATGAGGGAAGTATTTAGCTACCACTTCAGTGTTCTTCAGCAT
AAATCTTTGAAATTTAACTGTTACCTCTGTTTCCGAAAGACAAAGATGTGCAGAAGAGGT
GGGTTAATAATATTCAACGTTATAATTTTACAATTGCGGGAAAGACAAAGGTGTGTTGTT
GCTGACATCTCCAGTCCAGCGATTTGATCGAGCCTCGAGCTGTTTCACTGGAACAACTTT
ACTGTTTTGGCTCCATAGCCTGGAATTTGGTAAAGGATAAAGCGACCAAACGCAGACCCA
GAATGGTTTCAATTTTAAAGACAATTCATTATGAAAATAACATTTATTATTAATAAATTC
GTTTTTAGTTGTTTGAACTGAAATGAGATTCATCAGTGAATTTGACTTTTTTTGTTTGTG
AACTGATACTTAGTTTCAATCATATTAAAACCCCCATAGCTTTTCTTTTAGGTTTTATTT
ACGGTTTGCCTACTGCCCTCTGTCTATCATGGCCTCCTAACCATCCTATATCAATCTGTC
TCCTCTCCACCAATCAGCTGGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1208, 1461..1589, 3056..3164, 3258..3469, 3551..3610, 3901..4483
1095..1208, 1461..1589, 3056..3164, 3258..3469, 3551..3610, 3901..4086
NC_007120.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved