Danio_rerio Locus usp10
snOPY snoRNA Orthological Gene Database
Danio_rerio usp10
Danio_rerio
usp10
7
SNORD18, SNORA24
3574..3643, 23884..24040
39839
AGTCAATAAGTACAAGCTAACAGAGTTTATTTTAAAAATATCTTTTGTGTTCAACAGAG
GAAAGAAAGTCAAACAGGTTTGGAAGAAGTGAAGGGTGAATAAGTGACGGAAGAATTTCC
TGTTTTGGTTGAACTTGGTACTTGTTTATCTACTGTTTCCTTTTTTATTTTATTGCTACG
ATATATAAAACTTAATTAGAAAATGATATTATTAAGTAATATTTATTAAATATTTATTAA
ATATTAATGATATTAATATATATTAATATATTAATGATATTAATATATATTAATATATTA
ATGATATTAAATATTTATTAAATATTAATGATATTAATGATATTAATGATAATTAATATT
AATGATATTATTAAGTAATATTTATTAAATATTAAATATGCTCAGCATCCTAGTGCAAGT
TTGAATTTGCACGTCATTTTGGCGCGCCCACCCTCCCGGCAGAACGTCAACGCACGCACA
CGAGCCCGTTGAAGCCTGATTTATACTTCTGCGTCAAACACCGGCGTATGCTACGGCGCT
GACGCATAGCCCTTCGCCGTGGCCATCGCCGTCACTGACGTGCACCTCTCAAAAAATGTA
ACTACACGTCGCAACGACGCGTAGCATAAGCTCTGTGATTGGTCGGCTTGGTAGCGCTGA
CGAGTCTGGGCGGGACCGAGAGGCGCGCGAATGGCGCGACGCCGCGCGAGCGATTGTTTA
CAAGTGTGGAGTCCCGTGAAGGAGCTCCGGATGGAAAGTTTTGTTTTGTGTTTACCTCAT
AGTTAAAGTTGTTGCACGTCCGCCGGTTCCTGCCTCAAAATGAGCGAGTTTGAGCCACTT
GTACATCCCGGAAGTGTTCAGGAAATGCAAAAAAGTAGCGAAGAAACTTGACACAGAGGA
ACATTTACACCTCACTGCCAACTAGCGTTTCGGAAGTGTTAATGCAGACCGGCAGAGACA
GCGCGCAGAAGTATAAATGCACAGCCACGCGCGTTGCCTGCGCCGTGGGTTACGCCGGTC
ACCTGACGCAGAAGTATAAATCAGGCTTGAGAAGGGAGCGCGCGCGAGCGCCACTGGCAG
CACACAGGCGCGAGATAAAGATGGCGGCGACGGTGGGGGAAACGGCGTGATATGCTGGAG
TAGTGGCACTAAACCTGAGTAAAACCACTGTATGACAAACCATAGCAAAATGGAGACCAT
GTCACAGTAGGTGTTTACTGGTAATACCAAGTACTACAAACTCACCTTACCCCCCTACCC
CCCCGAGAGAACATTCATCTTGTGATTGTGGAGAAATCTCACCGGGAGCATGGCTTCGCA
AAGTAACCAGGTACGGAAACCGTTTTGAAGCTTTCATTTACAGTTTAATATCGTAGAGAT
TGTTTGTTTTGCTTTGTGCTGTACTTTCTGTTGGACTGTGCGTGCGAGCTCATTGAATCG
GCAGCATGGCTGCAGGCCCACAGCCTTCACGCGCTTATTCAAAACCACTAGCATTCCGTC
TGCTAGCTCACATTCAGGCGGCCATTATAATAAAGGTTTACGGGTGATTTACAGCTGTCA
TGAGGCTGTGTGTGTGGCATAGCGCTGAGTGTGTGTTTTTCGGCCATGAGTTTGTGTTTG
GCCCTCCCGCTCACGCTGCTGCAGCGGCCTGGCCACGCGCGCGTGCTCGGTTAATAACGG
TCATTAGCAGGCGGACGCGATCTTGCACTGAACACACCGCGTTTCGGCGACATTTCTGTC
GGATACCGCCTGTGTGGCACACTCCACCGAATACAGTAAGAAAGTGTTAAGTGTTTCCGC
GGAGTGTCTTCAGTTCAAGCAAGTTGAAATAGAGTCGTGTCGTGCTGCTAATGTAGTGAA
ATAGGCCTGTTGATTGGGGGCGGTATCGCTTCCTGTCTTCAATCCCATTCAAACTCTTGC
GTTTGACTTTTACGTTTGTTTCTTGATCACATCGCATCCATTATATTTCTAGTGACAGCT
CGTCACCACCAGGCTGTGTTTTTAGTGTCTTTAGACTGGTTTTGAAGTCAGCTAACTTTG
AACGAGGCGCCGTGGTGAAGATGCTACATCATTGTAGCTCTGACTGCTAGCCACATGCTG
AACTGTAGCGTCTCCACTGTGCTGTCAGTAAACGTGAAGTCTTGAATAATCAAATGCATC
CCGATCGCGTTTAATGCGATGCATAGGGCTGGTATTTGTATTTATTAATGACGTGTGATA
TTTAAATGTGCTACTTTCATAAAGTTGGACGGCTTTTAGCACTGTTGCATTGATGCCATA
TGGCTGAAATGTGGTTAGTGTATTAAATGTGTAAAGTTATGGGTCATTCTGCTTAATAAA
AGGTCTCTGACTGTAGGCAGTTTAGACACATAAAGCACAAGGTCCTGTCAAAGTAAGTTG
CACATGTCATTTATGCATGTAAACTTTGAATTGTGTGACGTGCATTTGTCACCTTGCGTT
GTTTTTAATAATACCTGTTTATTAGTACTACAGTTTTGTTAGGATTGTTGTAAGTAATTA
TTCTGGCAATGCTGATTGACATGGAACAACACCTTATGGAAAGTGTTTAGTTTTGACAGC
ATCTGAACACCGGTGCCTCAGCGTCATTTATTTCTTTACTCATTAAATTTTGATTATTAG
ACAGAACTGTTGATGTAAACAGCATTTACTTTATGATTAAAAAGGCAAACACTTCAATAT
TTTCACATATGTAGTAAATACACATTTGTATCTTTTGAATACTTTTAATAACTATTAAAC
ACTTAATGATGCAACTACTTTTTTTGCATGCAACTTGGATCTTCTGTAGATTTTTTTTTT
TATTGAATTTTTTTATGCATTCGTTTCCTGCATAAACACATTGGATTGGGACAGGAGATG
TAGTGTTTTAATGTTTAATGTATACAAAATTTGAATGACCCTGTCTATTTAAGACTCCCA
GTGTGCTCAAAAATAAAGTATAATAAAGGATAGGCATGGGCCGGTATAAACTTGGGTAAA
AATATCACAGGTTCACGGTATCTCACTATTGCGATTGCTGCTCTCAAATGAGTTCTTTTT
TTTAAATGTCTTGGTAAAAAACAACACTTTTCCACAATGACAATGATTTTAAGAATCATT
TTGGAGCAGTAAACATGTATGGCTAAGTAATTAAAACAAATCATTGACGTTTGCTCTATT
TGTTAGTTTCTAAAACACAGATTTCTTAAGGCATCTTTAAAAAAAGGCATAAAAGGCATC
TCTTGATATATTTTCTGCTGTAGATACTGTTCTAAAAACATTAAAAAAAAAACCTTACAT
GTGTCGTAGGAACAGTATAACAGAGTTTTTGTGGTATTAAAACTTTAACTTTTCCAAACC
ACGGTATACCTTGAAAACGGTTATCGTCCCATGCGTAATTAGAGGTAGTAATGGGCCAGT
GTAAGATTCTGACAGTATGATAACCTTAAAAAATATATTGGGGTTTCACAATATTGTGAT
GTATTTCTTTCCCCTTTGAACACAATTTAGTTAATCTTGAGAAACATTTAAAATATTTTG
GAGCAGTAAACACGTCAGGCTAAATCATTTAAGTGAATCATTGACTTGTGCTGTCTTTTG
TTTCAAAAACACAGAGTTCTTGACAATTTAAAACGGCATCTTTGGAGATCTTTTCTGTCG
GATATACTGTTAAAAACAAAAGTCTGGAGTAAAAAAAATCCTACATATTCCATAGGAACA
GTATAGCAGAAAATGTTGGCGATTTTTAAAACCTTGACTTTTCTTTACTGCGGTATACTT
TTGAAAAACGATTATTGTCCCATGCCTAAAAGATTTGATTGTTTTTAAAAAAAAATGCTA
ATGCATTTATTCTCTTGTTTATTTCTCCCTGCATATGTTTTTAATTCAAATTCATATTCT
GCATGTAAAATAAATGTATCGGATAAGCTTCACTTCAGCAGATTTTATTTACTGTCTTTA
AATTATATGGGCACGCTTTACGAAAAGATTCCCTTAGTGAAATGTCATTATATTTACTAA
CATAATTAAATAATAAACAATACATTTATAACAGTATTTATTCATATTTGTTAACATTAG
TTAATACAATTGCAGCACATTAATGTTTTTTGGAATATTAAGAGTTATTAAACTAATAGA
GCTCAGAAATGTATTGGCAGATATTTATTTATTATTTTGAGGCAAATAGCCATTTAATAA
GAGGGATGAAGTACATCCAGGATGGTTATATTCACAGAATAAACCCATTCAGGCTTAAAC
AGCGGTGCTTCGCGCCAGGCTTTATTCTGTGATGACAACCTCCTGGATGTACTTTATCCC
TTACTTAACAAGCACTAATTTTGTATTAATGCTTTCCTATATGATTAGTAAAGGCTTTAC
ACAGGATGTCCGTGGGGGTATTAAAATGATAAATCAATTTAGAGAAATTTAAGACCCTTA
AAGTATTTAAAAGTCTTAAAAGCTATTTTGGAGGATATTAAATTGTATCATGTTTGATAG
TCATGTATAGTTGCTTGCTAAAGTTTGCCTTTATTTAATCTCTGAATATTGGGGTGCTGT
GTACTTTATAAAATCTGCTGCTTTGCTTACAGCACAATAACCAGGCAAAGAGTAAAAAAA
GTCACATGCTCATTTTATTTTTCTATTATCTTTTTCACTTTCTACAATATGAATCGGCCA
ATTTGCTAGTAAATAAATGAGTTTAAAGTATCATTAATTCATATAAATGTTAGAGTATTT
GTTAAAGCCTTTTAAACTGGTTTAATTATTATTGTTTTGTATTTCTCTTATAAACTTTTC
ATAGGGGTAGTTGGGTAAATAATTTTTCTTGGTCTTTGTTGCCTCCCTATGTTGCCTCCC
ACAAGCTGAGACTGTGCATTTGTGCTTTCTTACAAGTTGTATTTTAATGTACTGTAAGTT
AAAATGTCGCCAATGTTAGAAGTTGAAACCTAAAGTGGTGATGAGGTCTTAAAATATATG
GAGAAAGTCTGAATAAAGTTCTTAAAAGGAATTGAATTTGGTTCTCTGATTCCTTCATGT
ACCCCGTTACAGGTATTGTTTCTTAATGTATGTTAGTAAATGCATTAACCAGCGTAATGA
ACCCTAGTAAAGTGGTAACAATAATTTTATATAGCGGTTATACTTTATATAAAGGTTGGC
CACCATGCTTTCCTATAATGGCATCAGCCAATGAAGAGAAAGAACCCAGATTGGTTGACC
ACTGCATTATTTTTAATCTGGCTGGTTTATGTTGCCCAACTGTAACTGAGACTGTGTACA
CAAGTGTCAAGCAGAAGTTGAGTTAACTGTAATTTAGAATAAATTCACTGCCTGTTGGAA
TCCCACAACACGTAAACAATAGTTTCCGACTTACTCAAGTGCATGCTTGACATGTGTGCT
GCTCTGTACCCTCAGATTCCCTCAGCAATAGTCAGCCGTTACAAAACCCGGTGAGCCGAT
GTGTCTAATAATGCCGTGTGACAGACTTTGCCAAACAATGTCAACAAGGATTGGGCATTA
TTGGACTGAATATGTGAATTGCATTTGATGACGACTGCTTTTAGAATGAAAGAAGTGCCT
GAAAATGGAAGTTGGCCGTAGCTCTGGGTGGGGTTAAGAGAAGATCCCTTAGTAATAGAT
AAATAAAAAAAACACAGGCAGCTGATGGACACTCTTCAACTATGAGGACATCTGTTTTAG
AAGCTCAGTGAGCTGGCATCTGGGATAATGCCATCTCTACTAAAATGGCATGGTGGGACA
AAGTAAAACTTGGATTTTAGTTTCTTTACATCGGGAATAGCATGTATAGTGAATCTGTAA
CTTGATGTATTGGCTAATTTGGTTTGTGTGTTGCTTGACTTGGCATTTTCACTCTTGGTG
ATCTGAGCAGGATAAAAGTCTTGTTGAGAGGCCATATCAATGCATTTGAATGTGGCATTT
GTGTGAGAACATGTTATGCACTTTTAAAGCAGATCTAAACCAGAAAATCAAGTGACTCGT
CTGGTTTGTCCTTATCTGCGGGGGTTTGTTTGACAAGTTTTACATAAAACCACAGCGCAC
ATTGAGCAGCTACTGCTTTGTCTTCATAAAAGTGGTTTTGTTGCTTTAATACTGGAAAGT
AAGGACCAATTATAAAACTCGAGTTGCCGTTGTCACATGAATGTCAGAATGAAACTGTTG
TGATGGTCTTTTCTTCCCTTTTGTGATCTGTAGTGCTTTAAGTTGTATCATCTTAATTCG
ACTGAAAAAAAAATTCCCCTATTTTTCTGTGTTCCTTATATCATTTATGAAAAAATGCAA
ATGATCTAAAGCAGGGGTCATTAAACTTGTTCCTGGAGGGCCGGTGTCCGGCAGATTTTG
GCTCCAACCCTAATCAAACACACCTGAACCAGCTAATCAAGGTCTTACAAGGTATACTTG
AAACACCCAGGCAGGTGTGTTGAGGCAAGTTGAAGCTAAACACTGCAGGGTCACCGGCCC
TCCAGGACCAGGATTGGTGACCCCTGATTTAAAGGCAAGCCTAATTACTTGAAATAATGA
CACTCACTAAATATAACTAAGAATTCAACAACATTGTTTTAAAGGGTGAGTTGTCGCCAT
TTACTTGATTTATTCCAAACCAGTTTTGTTTAGTGTTCTTTTGAATATTGAAGAATGCTG
TAAACCTGTAACTATGCATGCATAGTATTTGTGTTCTCATTTTTTACATTTTACATTCCC
TTTAAGCAGTTTTCTTCATTTGGTTTACCTCTTTTACAAACATTACATGAAAAATTAGTA
TTTTATAAAAAAAAATAATCTGCTGTACAAAAGTTGCTGTTAAAGTTTTGACAGCTTGTT
TTAAAGATACTGAGTTTGTTTACACATGATATGAAAGTCTTCATACTGTAGTAGGCATCG
GACGATAACCATTTTTAAGGTATACTGCGGTTTTGAAAAGTCAAGGTTTTGAAAATGCCA
ACATTTTCCACTATACTGTTCCTAAAGTGATTAATATATATATATATATATATATATTTT
TTTAGGACAACAGTATCTTAGAAAAGGTATCCAAAAATGCTGTTTTAAATTATAAAGAAA
TCTCTGTTTTTTTTTAAAGAGCAGAAGCCAAGGATTTATTCGAGTTATTATACTGTTATT
CAGATGTTTACTGCTTAAAAATATTTTAAATGTTTCTAAAAATAAAATATATTGTGTTCA
AAGGGGGGAAAAAAAAAATATATATTTTTTAACCCAGACATTTAAAAAAAACTTATTTTA
GAGCAGTAACCAAAATACCGTCATACCGTAAAATCGTGATTTTTTTATCTAAGGTTATCA
TAGCTTTGGAGTCGTATACTGGCCCATGTCTATACTGTCTTTAGATGGCAGATTCTGAGA
AACTTTTTATTACGTTAGGTTTAGGCATGGGATGATAAGCTTCAAGGTTTACAGCAGATT
GGAAAAGTACTTTTTAAAACTGAAAACGTTTTGTTATACTGTTTTTTTCGGTGTATATGT
AATGTGTTTGTGTGTGTGTGTGTGTGGTCAGACTATTTTATTCATTATTTTAGGGCAACA
GTATCTAAAACAGCAGAGGACCATCTACATCAAACGATACTGGTCAACTCCCGATTAAAC
ATACATTTGAAAACCAAATCGCATACACCAACATCCAAGCATGCTATGGACCAGAACTGT
GAAAAGAAAGATATCCAAAGATGCCTTTTCAAGTTGTAAAGAAAGCTGTGTTTTTAAAAC
TAATAAAGCTCAAGGATTTGTTTTAATTAAGCCTGACATGTTTACTCTTCCTAAATAATT
AATGTTTCTTATAATAAACTATATTGTTCAATGTGGGGAAAGGTTGTTTATCAGATATGT
TAATAAGAGCAGTAATCACAATGCCGTGATATTTTCTTCTCATCATTAGGTTACAGTACT
TTTCCAGAGTACTGTAGTTTGAGAATCCAGAATTTGCCTTGATTCTGTTATACAACTAAT
CAAAGTTTTTTAATGACTGGATTCTGCATTTCCAGCCCTTAGTTAATCATAAGGCCCCAG
ATATTGTTTCTCAAATTATGATCAAATCTTGGGTGAGAATTTTCTCCTCGGGTATTGATG
AAAATTGTTGTCATTTTCTAATTGCTGTGATCTCTTGTGAGTTTCAGACTGCTGATTGTT
GTCCTGTCGTTACAACAGTAGGCACAGAGATACTTATTTTAATCATTTGTTCATAAGTCA
TTTGTAGTCACTTTAGCTGTGATTTTTAACTGTAGTCCTGTGCACGAGGGCTGCAAAATA
TATCGTTTTTACTTTAATAACACAATGTGCAAATCTGCAAGTCACATTGCAGAATCTGCC
ATGTCATGTTGAAATTAATATAACATGACCTAATAGGTTCTAAATGTGGGAAAGATGCAA
ATTATTATATAGTTTTAAGGCTTGTGACTGTAAGATTAAGCTAATTTAAACCATTTGGGC
ACTAAAAATGCTAAAGTTTGCTGCTTTAACAAAGATTTATTATTTATTTATAAAAGAAGA
CTATATGGTGGTGTTTTACATTTGATTGCGTTTCTGAAACTCTGAAACAAGGAAAAACAG
TTTTTTTCTGTTGTTTTTATCAGTGCTTAATTTTATTTTGTGTATTTTTATATAATTTTG
TGCAGATGTACTCCCCTACAAAACAATCCCAGTCAATGTAAAATGAGGAATTCTTTCCAA
ATAAAGTTACTGTAGTCATCCTCAATGTGAAATTATATTCATATCGCATTATATATTGCA
GAAAAACAAAATCGCAATGTCAGTTTTTTCCAATTTCATCCAGCCCTACTGTGGGCCACT
GCTTTACACAATTGTGTTTTTATTAACTGACACTTCAGTTCAAGGAGGTTTCCGTGGATG
TAAGCAAGACTTGCAAAATGTGCAGAGCATTTGGTCTTCAGAACTGGAGTTGTAATCCAC
TGTACTACAGTATTTCATAATCCAATAAGAATCATCAATTTTGATTTCATGGTGATTTTA
GATGTTACTCAATTTGTTGCGTGAGTGTCACCTCGGCTTCTCATTCACGAAAGATTGTGT
GTGTTTTCTCACCAGAGCATGATGAAATAATGCAGATGGCTAATTTGTAGTAATCCCCTG
TCCAAATGAACAGCTATGGGGAGCTTAGTGTGGTACGTGTGGCACGCCTGTGGAAAACGG
GCAAAGAGACATTCTTTCTGTTGTGATTGTGCTCGCCATCCAGAGGCCATTGGATTACTG
CTTGCTGTTTGTCCCTTGTGGTGCCATTTCAGCAATGTAGGTCGGTGATTCGCAAACAGT
TACATGTGCTTGAACTGCACTTTCTTTCTTGCTCTCCCTTTTCACGCGGCGAGTTGTGAA
TGTAAAGGGGTATTATGTGCACGTTTACACAGCCCTGTTCCGTTTTTCATCTGTGACACT
TGCAGACTTGCATGAACATTACCAATGAGGTGTGATGTTTTTAAGTCTGTTTTATTTTTT
GGTATTGGTTTGTTACTAGACAGTGTAGAGCTTTAGTCTCAACTTGGTGCAAGAGTCTTT
AAGTTACTCCTAGTGCTTGTTGGATTAAGATAATTATAGCCTTCAGAGGGGAAGCAGGTT
GTCTGAAGGATGGTCTGACCATTATAGGACTAGACACCAAGTGAACACAAGACTTCTGAT
GGTTGTAATAGGCCTTTGACTAGGGCTGGGCGATCTGGGATAAAAAAAAAAACATTTAGT
TATAATTCGCAATCAGGCATGGGCCAGTATAATGCCTCGTTTCCACTGACTGGTACGGTA
CGGTTCGGGTCGGTACGGGTCACCTTTATCAGGCTTGCGTTTCCACCACAAAGGGTACCC
TTTTGGTGGGCGTGGTGTATGACAAAGCTCAAGTCGACATCATGCTCGCTCGAATAAATG
TCTACAGTAAAGCTGTATGGGTCGTTCACATATCATAATGAGCAGCAGATGCTTTATACG
CATAAATACTTGTTTATAAATGTTTATTACTCACTTTTCTTTAAACATAATTTGATTATA
ACTGCAGATCAATGACAGTGCAAAATAGGCTACTGTAACGTCTGCAATTAGATTAAATAA
ATTTATAAATGCAACAAATATGAACACATCCCGCCCCTTACAGTCTCCGATATATTATTA
ATTACAGAAAAACTATACACAGCATACATTTAGTACTTATTTGAGTTAAAAACACATGCA
ATATAGCCCACAGTCAGCGCAAACCTCTCATCTGTGTCTGTAATCTTCACCAGCACAAGT
AAGCTCTGTTAGAGAGTAAATTTGTCATTCCCAGTTTATAATAGTCCAAAAGACGAAGAT
AAACATGGCAGTTTGTTCATGATTCAGGTTGCTAAAACTATTTTGGTCCTGTGTTTTGAT
GACTTCGCCTTTTTTTCCCACGTTTCACTCTCGCTTCACTCTCGCGCTTGTCCTTTTTTC
CTGAATAGATCAGATGACGGAGACACTTCAATAATCGCACACACGTTATTATCATGAGCT
CAAGAAGTTTGTTTTATCACATATAGACGCGTTCGCGAGCTCCCGGAAGAAAGCGAATAC
TGCTTGCACTTTTAGATGGGCTCGTAAAGCAACAACAGCACACGGCAGATTTTTCTTCTT
GGCTTTGTGTTTGTTCACCGAGACGATGTCAAGGTTTGTTTGAGCCCCGGTCATCCATGG
CTCGTTATTAAATGCATATAGTATTTCCATGTAATGTCTCGGCTTTGTATTTAAAAAAAA
AACAAGGTGGTTTGTTTGTTTTCTGTGTAGCTCCATGAGCTCGTGACGTATCTCTGTAAC
CAATCAGTGTTCAGCTGCACGTGTTGGTCCACCTTTTGGCACCCTCTTTCCCGTTTGGTA
CCCTTTCGAAAGGGTGCCGAAAAGTGGTATGGTTTGGTTCGGTGCGCTTTTTGACAGTGG
AAACGGCCATAAAAGAGTACCGTACCGAACCACTCAGTAGAAACGGGCCACAAGTTTCTT
ACAGTATGATAAAACCTTAGATAAAAATATCAGTTTAATGATATCACAGTTTTCTGATTA
CTGCTCTAAAATGAGTTCTTTTTAAATATCTGGGTAACCCAAAAGTCAAGCCAGCAGATG
AAATTGGCCACAGTGAGAGAGAGAGAGAGGAATCGAGTACTTTCATTCCCTCAATCGCAG
ATAAATAGGGTCTTCTGCTGTAGTTGTCAGTGAAAGACTGTACAGAAATCGCACACACGC
GGTAAAATTGTGCACAGTTTGCGCCAGGAGTGTTGTAAATACCCGCGCTCACCTCCCTCG
CGACAGAGCTGCGGCCCTCCAGGAACTGTATTTGACACCTGAGATTTAGACTATCAATGC
AACCAGCAGATATTAATGAAATGCCTAGGATTTGCTTTGTCCATTTTAGATTTGTTTTAA
CGATACAATTAGAGATGGTTAATGTCTATATAAAAACGAATTTACACATTAATTGTATCT
TATTTAGTAATCACTAGAAAATGTTTTTGCGCATTCATAGTGCTTCTGTCCAGCTGCATT
AAACTACGTTCTTCTCCCTCAAATATGTCATGCATCATTTGAGTTAAAATGATTGGATGT
CCCATGAGATAAAAGGTTATTCAACAATGGCAACGTTTGTTGGCTTGGAGCCTTAAAATC
ACCAACAAGATATAATGTCATGTGTTTTCTCATCTGACCAGTGTCACACATCAGGAGAGT
GGACTTGCTGTTGCAGAAAGCTAGCATGACTAATGTTCAATTGAAGCGGTGGGATTGGGA
GGTCAGAAGACTGGCAGAGAGATCTGGCACTCGGCAGTAATTGATGCTGTGTTTAGATGG
CATCTTTCTGCCTGTGGGCTATGGGAAAATACATGGAAATTCTTTTTTTTTTTTTTTTTT
TTTTTTGTGGAATTTTATGAAGCGCAGTTGGTCAAAAAAAAAAAAAAAGCCAATTTGAAG
CATTTGTTGAGTAAAGATCAGATCTATTGTGTTGTAAAAGTTTACTTGAAGTGTTTGATT
TCAATGAACAAAGATAACACCACAAACTTAATGCCACAACCTTCACGTTATATTCACTAA
TGTTTAATTGTCAATGCTCAAACAGTGTTAAACATTGGCCAAAGTGAGGGCCTGAAGGGT
CTCTCTCTGCCCTCGCTTTACTCTCTGTAGTGGGACATGAGGGAGCCATATTACCATGCT
GCATGACTCATCAGTTTCCATCTCGCTCTTTACTTTCACCCAACCTGATGTTGCAATCAT
GCAGTAATGATGGCTGCCGCGTCCTTGTTTACCCTCAGACATCATACTTTATTTGTGTAT
TAAAAAATAAGAAGGCAGAACTTAACAGATTTAGCTTTGTGCTGCATACACAGTGTTAGC
CATAAAGCCAGTAAAATTGTTAAAAGTGCCTGTCAATTGTGAAATGTCACCTAATGTGTT
GTATTCTGTTTGATTTTTCACAGTATATCTTTGGGGAGTTCAGCCCAGACGAGTTCAATC
AGTTCTTTGTGACTCCCCGATGTTATGTTGAGGTAAAATAATTACACACATGAATCTAAT
ACACACAAATGTTTCAAATGTCATGTCCATATAGAAAACAAAGTAATACATTTAAAATAA
GGTATTGTAAGTACATTTGTGCATTATTTGTGTAAATTTGACCATTCATTTAATGATTTT
TTGAATACTCCTTACTTTCAGTATGATTGTTTATTCCATATAACCAGACGTACTGTGGTG
AGGAAGAGCTTATTCACACCACTTCGTGTATACATGTTCATTTTTTTTTTTTTTGCCATA
TGCAGTATGAAGAGTTTAGAAAAAAAATGTCCTTTTTACATTTTCTACCCTTATTTTAAT
ATGTTCAGTATTTCTAAATATAATGGCATTTTTTTCTAAAATATTATTAATGTTTCAGTA
TTGCCTGTTTCCACTAATTGGCATGGTACGATTTGGTACGGGTCACTTATCAGGTTTGTG
CCTTCACTGCTAAATGGTACAAATAATTCCCTTTTGGTGGGCTTGGTGTTCGACAAAAAG
GTGCGGTCGGCTTCATTATTGCTTCAAGTTCAAATATCATATGAGAAACCCTTTTTACTA
AACAAATGATTTATATGCGTAAATGATTGTATAAATGTTTATTACTAACCTGAACAGGAT
TTGATTATAGCTGCAGATCAATGATAATGCTAAATATTCTACTGTATCATTCGCGATTTT
GTAAAAATAAAATATTTATGAACGCATAATGAGACTTACAGTCTCTGAAATTTTACCAAC
AACAAATAAAAATTCCCAAAACATACATTTAGGCCATATTTGGTAAATAAATGATACAAA
ACGTATACAGTCAGTACAAACCTCACATCTTTGTTCTTCACCAGCACAATGTTGACATCT
TGTTAAAGTAATTCCGTCATTCCGATTTAGTCCAAAAGGTGATGATAATAGTTAAACATG
GCAGTTTGTTCATGTTTTAGGTTGCTAAAAGAATCATTTGCTCTTTTTTTTTTCTACTTC
TTTCTCGGCTTCTCCTTTGCTTTTTAGCGCTTCTCTCGTGTTTGTCCCTTTCTGAAAGGA
TCAGATGTCAGAAGTGCTTTAATAATCACGTGCAGCCATATATAACTATAACGTGCACAT
TATCAGCTCAAGAAGTTTGTTATTTCATAGATGGATGTGTGGCGAGCGATTGCGAGGTCT
TGGGAGAAAGTAAAATCACTTGCGCTTTTAGACGCCCTTGTAAGCAACAAGACACACAGG
TTCTGCTCTTGTTCTTGGCTTTGTGGCTGTTCAGCAAGACGACGACTAGGTTTGTTTAAG
CTTGGCTCGATCATGACTTTTTATTATGTTTATATTATTATGGTTTCATGTCTCGGCTGT
GCATTTAAAAACGGTGCTTCCTGTGTTTTCATTCTCCTGGCTTGTGCATACACTAGTGAC
ACTTCTCTGTAACCAATAGCGTTTAGCTGTGTGTATAGCTGTGTGCCTTTTGGTACCCTT
TTGTTTTGCTAGGTACTCTTTGGAAAAGGTACCCAAAAAGTGATACAATAGGTTTGCTTG
TTGGTTTGTTTTGACAGTGGAAACGGGCATAAAAGCATACCGACTCATACCAAACTACTT
AGTGGAAATGGGCCATTAATGATCCTTTACATTTTTCTTTAAATTTGCCTCTAATGCAAA
AAGTAGTCTTAATTTATTTTTTTTATTTTGCTCCCTGTTGTTGTTGGTATAAGGCAAGTG
TAACTTAAAATACAGAACACCTCTTGGCATAATATATTACCAATGTGGTGCCAACATTCT
CTTTGTTTACTTTTTTTCTTTTTACTCTAATAAAATGCCAAGTCATTGTTTAGTTTTTAC
ACATCGTTTTGCTGTCCATTTTGTTTGTACATTCGACTCTGGCCTTCCATTCCAAAGTAC
ATGTTATAATTTTTTTTTTAAAAACCTGTATTTAGTTTAGATAACATGCGCTTGCATTTA
TAGGGTTAAGGAATAAAGGTTTGTTTGTGTGCATGTTCTTCTATTGACTTGATGTGATTG
AGTGATCTCATCCAAATTTCTTATCAGCTTCCCCCGTTCAATGATAAAGTCACCTGCGTC
AGCCATTCCTCAGGTAAGATCAAAGCTTCATCTGAATATCACTACAAATACTGCTACAGA
AATAAAGATATGAGTTCTAGATTGCAAGATCCTTAATTACTCCCACGTAAGCAAACACAA
TGGTTTTCTATCATGTATTATGCTTTGACCATAGCTTGCTTCGTCACGCATGGGATACAG
AGTTCATTTATATTCATCTGTCCTATTCGCATCCTAATCCTTAAATTGTAGACTGGTCCT
CATTCATCAGTTGTATATAAAGCTCCTTGGGCTACGTTCCCATCTCTGTAGTCTTAATAA
TCTTTCCCGAGACAGTATCATATTGCCCTCTCAGGTAGTTGTGACCTTCACCCTCATCTG
TATCAATTATTTAGGAGGTTACTGCACTCCTGCTGTGCCTTACATAACGGAATCATTGAG
ACGGCAGGTTTGCGGTGAGTTTTCGGTCCACTACACACCGCCTTAATCTTCTGTTTTTGT
TGCAGAACTCAACACTTAGGTCTTAAACACTGACAGCTTTCTAAACCTTCCCCTTTACCA
AACCTTAAACCCCTACTTCTTATTCTTGCCTGTCCATTTAATCTTTGGAGCTTTGCATGC
CTAGGTGCCAGGCGTCTCTCTGGCGCATAAGCATCTACTTGCAGTGTTTGGAGTTGATGG
GAGGCTTTATTTTTGGTATTACTTTTTTGGAAATTCTCTCAAAAAACACATCACATCTAA
GAATATGACTTCATGGACCATTTTTCAGGACCTCTAACAGAATATCACCTGAACATGTGA
CAGTGTTGACTTATGTTGCTTATGAGTTTGCCATCCATTTCTGCCTAAAATAAAACATCT
AAAATGAATACTAACAGAGGATGTGGTCTTATCTATTCTTTGATCCATTGCTTGGGAACT
TGTGTTCCCTTTATGACTTAAGGTTGCTTTACTTTTCTGACTACTGGCTACTTCTGAGAC
TCGAATTCGTAGAGTAATTGTGACTTGCATTCACTAACACTGTTTCCATTCACTTCAATC
TATCCTTCACTGCTTAGTCTGCACCGTTTAGTACCACAAACACTTTCAATTCAGAGTCTT
TGTATATAAATAACTACATGGTACCTCTAGTATCTTAGTAATTGAGTGTTTTATAAAAAA
AAAAAGATAAATCAGATTTGTAACAGAAAATCATTACAATTATTTAGATGCACATGAGTT
TAACTGAGATGTTTCGATCTGCAGGAGAGGACTACCAGCATATTGAGTTTGGTGTGGATG
AGGTAATGAATGCAGAGCCTGTGGCAGTGAAAGACTCGCTGTACAAAGTCTCTAGCACTC
TTAATCCTCAGGCCCCTGAGTTCATCCTGGGCTGCCAACCATCTCAGAAGTCCCTTGCCA
CAGCTACACCTGTTGCTGATATCCCGGACGGTGCCGAGTTCAACTCCCTATGCTGCAGCA
ACTCTGAGACCTCAGACATGGGCAGCCATCAAGCCTGCTTGGACATGGATGGGGTTTCGG
GTGGCTTGGGACAACGGAAGAAAAAGAAAAAACGACCGCCGGGATACTACAACTATCTAG
AGGGTTCAAACAGCAACAGCACTGGTGTGGCCACAGATGGAGTGGGGCCCCCAAGCCTGG
TCAACGGACATTCACCAAATGCTCCACTCCTGAGTTCAGAGGACTTGGTTGGGGACATTC
TACCTGGGGCAGAGCTAATTCCCCCAAATTCTATAACATCTGCACCCCAAACCACCCCAC
TTTCCAATCAGAGGACTTGTGAAAGCCCTGACAATACATTTGACTTGACGAGTGGAGCTG
CCTCTTTGTTAGACAGAAATGGTGCAGCTTCTTTGTCTACTTCATCTTCGTCCTCTCAGA
GCAGTGGGGTGGCACAGAGTGCCAGGACTGCAGAGCAACATGCAGAACCCCCTGCTTTAG
AGAGCCCAGTACTTCTGGATAACGGCGGGCACAGCTCCTCTCCACCTTCCCCTCTTCCCT
GTGCTGCTCTGGCCACCCCTACAACCACAATTCCTGCTACTACTGATGAGAGGGAGGCCG
AGGGCTTGGGGGAGGCCAACGGGCTGCCAGAGACCGCCTCAGCTGCTGGAGCTGTGGATG
AACTCCAGGACTCCTCTGAAACGAGTGAGGTGCAGTCTGCTTCCTCTCTAACCCCTCTCT
CGTTAGACTCTGACGTTCAGCCGGTGGTCTCGCCTGTTGTCCCGGCAGCACCTGCGATCA
CCCCACCGAAATCCTGGGCAAGCCTCTTCCACAACTCCAAGCCTCTACCTGGAGGTCCTC
AGGCGTATGTTGAGGTGAAGAGTGTGCCTGCTGTTGTCACATTCACACCGACTGCCTCCG
AGTTGCCTGAAAAGGTCAGTGAGGTGCGTGAAGGCCCTGTCCCCGTGTCTGAAGACCCTA
TGGCCCCAAAATTGGCAGGTAAAATTACATGATGTTAATGGTTGAGTCCAAACTGCAAAG
AATGCTGTATTGCACTAAATGTAGTTGTTTGCTTGCTGAAAGTTACACCTAAGCAAATTT
TGGTCCAAAACAGGGGTCCACCAACCTTGTTCCTGGAGAGCTACCTTCCTGTAGAACTCA
GCTCCAACCCTGATTAAACGCACTCGAACCAATAAATAGGACCTGATACAGCACTTGATA
ATTACAGATGTTTATGGAAGGTCAAGGTTGCAACTGAAATCTGCAGGAAGTTAGCTCTCC
AGGAACAGGGTTGGTCACCCCTTACTGGAGATTGGCTGCAAGTGTATTTTAAAAGTTGTT
CTGTTGTTTTTCAAGGATTGCTTGGTGCATTCTCTACTAAATGTTAAATTCACCCAAAAT
GAAAATTGGTCATTTAATCATCATTCCATAAATTTTTCGTTCAGTTTACTCAATGTGATT
GAAAGGGTCGTCGCTGCAGAGCATCTTGGGTAGAGCTCACCTCCAGGGTGGGGGAGCTTA
AGCTCCAGCTCCTCCACCTGTAAGCTGTTTTAATGCGTAGACCTACTCCACCCCTAACCC
CAACCCCCAGTGACGTCACTTGTAGAAGGACCGGGAGCTCTAGCTCCCCCATGCTGGAGC
TCAGCTCCGCCCATGTAGCTCTGCAGTGAGTACCACTTGATGCAAATGTTTTTTTTTTTT
CCAATTTTAAGGTTTTAAGACCATTTTGTTCATCATGTGAAATAATTGTATCTTCAGAAT
ACTTGGGTCAAACAGCTTTCTTTATTTGGAGCGCTGGCTTTCAGAATTGTCAATTTTGAA
CGGAGAAAGTTTTATCTCTTAACTTATTTAAAAAAAAAAAAAAGGTATAACCTGAAATCT
GCCTACACAATATATTTACCTGTTTGCAAAGATTCGTACCTTTTTACTCCTAACATTCTT
GTATCATGTTGCAGAATCATGTCAGATTAAATGTTGCTTCATTGTTTTACATCTCAATAA
CAAATGCATGCAGTTAAAGAAGGCTGAACAAGCGACTTGTGGAAATGAGGTTTATTATTA
AATGTAGACCATTACACAATATGAGCCCAATTTGACAATCCATATTGTATGGTCTAAAAG
CAGAACTATTTTACTTGTATAATTGTGTGTTCAAAGACTTTGGTTTGTGACATGTATTTA
TGACATATCTTGAATTAAATAGAAATGTCTGGTTTATTAGCTTATAATTAACCTAATATT
TATATATTTGCCTTGAATTTACAGTAATGATTAGCTAATTAGACCCCCCCCCCCCAGAAA
GATCTCCGAAAAAAAAATTGTACTTGTTTAATGTTTATATTAGTCATTTTCTTGCAGCTG
TTTTTCTCTACAGTGATTGTACATTGTGTTGGTCAAATACGGAAAGCTCCATGAACATGA
TATTAATCTGTTGCTGTATTCGTTTTAATGATAGCTGTGTATGATCATGTTTTGCTATCT
GCCTTAGCTTTTTAAAATTAATGACCTTTATTATTATTATTTTTGTTTTTATGAACAGTA
TTTCTGCGTATTTTTCAGATTTTTATTTGAGATTTTACAGAAGAAATCAACAGCATGTAG
CTTTGTAATCACACTAGTGTCAGTTCTGATTTACGGGCACACCATTTCTTCTTGATTTAA
TGTGGGTTGTGTTTCTGTCCACAAGATGGCAGCAGTAGCATGTTTTATTGCTGGCACCAA
TAAGTTCTCTGTCCTGTTAACCCTAGACTGGTTTTTAAAGCATCTCGGCTCCTTTAAAAA
TATGTCTGTCTGTGTCTACATCTATCTATCTGTCCATTCATGTCTGTGTGCTTGTTTGTT
TTTCTGTCCATTCATCTCATCTATCAATTCATATATCTATCTGTCCAATCATATGTCTGT
TGTGTCTGTATCTATGGTTCTATCTATATATCTTATCTGTCTATCAATCACCAAATGAAT
ATCATATTTGTCTGTCCATCCATTAATTTATTTGTTCATCTCTATCTGTCTGTTCTTCCA
TCCATATATCTATCCGTCCGTCCATCTATCTGCCCATCTATCCATCTATATATCTATCTG
TTTGTCCGTCCGTCCATTCATATGTCCGTCTGTTCTTGTATTCATCTATATTCATCTGTC
TGTCTGTCTGTCTGTCTGTCCATTCATCCATCTAGCTATCTAGCCAGCCATATATCCGTC
TGTCTGTCTAATCGTCCGTCCTTCCGCCTGTCTGTCGATCCATATATTCATTTATATCCG
TCCATCCATTTATCTGTCTTTCCGTCCATCTATCCGTTTGTCCATGCATCCATCCATCTA
TCCATCCATTCATCAGTTCGTCTATCTATCTAGTCAGCCATATATCCGTCTGTCCATCTG
TCTATCTATATAGCCAGCCATACATTTCCCTGTCTGTCCATCCATCTATATATCTATCTG
TCTCCGTCCATCTATCTGTCGATCCATTTCATCCCCCTTTATTTTATGGTTGCATTCCAA
ATAATCATCTCGTTTTGATGAAAGGCTCACCCAGGTGCTGTATTTTAATACATTTAACAT
TTGGTGGTCAGAATAAGAATACAAGTTTCGAGATCTGAGTGCTAATTGGCTGCAATAGTG
ACTAATCATTCAATACATCAGTGTATAATATGGAACAAAATCAATGCCTAAAGTCTTGAA
TTAAAAAGCTAGTTGAATATCACAAACTGAAAAAAATAAGTTCTTGCATTTCAATGACTT
GAATTCCAGGGTTTGTATTTTTAGGTCCTGAATTTTAACATATCTGTTTATTTAAGCTGT
GAATATTTCAACGAAAAATATTTCAAACACGTTTTCATACTTAAAAATTCAATAATTCAT
ATTCAATTTTCAGAGCAGGTAACGAGCCAGCATGGGAGACAAGCTCCGATAAGATTGCAG
AACAACGTCTGTCCCTGGATCCGAGGAGTGAGCTTTACGCGATCACCAGCTGGCTTCCGT
TACATAAGGGCAAATATAGATGACTAAACCCTCATTTACTCATTGTCCAAGGCATTGATA
TTAAAATTGAATGCTACTTTTGTGCCTTTATTAGCCTTTTTCTCGCTTGTTTACTGGGTT
AAAAATCTTACATTATTCCATCTCCACCTGCTGGTGAAAGCTAGAGCAGCTGGCGATCTT
CAATCTGCAATCTATTGCTTCTCCTGCAGATCCCGGATGTAATGTTGAATTTTATCAGTC
GAATTTGATCCACTGAATTTATGGAAGCGAATATTAGAACTGAAATAAAATGAACTGAAA
ATGACCTTTTAAATATTATACATCGTATTTTTAAAGGGTATTGGATATTTTGTAAGTGAA
ATCTGAAAATTGAATATGAATTATTGAATTTTTAAGTATGAAAACGTGTTTGAAATAATT
TTCGTTGAAATATTCACAGCTTAAATAAACAGATATGTTAAATTTCAGGACCTAAAAATA
CAAACCCTGGAATTCAAGTCATTGAAATGCAAAAACTTGTTAATACGGTGTATTATTTTT
TTCAGTTTGTGATATTCAACTAGCTTTTTAATTCAAGACTTTAGTCATTGATTTTGTTCC
ATAGTATAATCACCTGATCTCCTGATCTTGGAAACAGTCAACAGGACTCTCCCACACAGT
AAATCATTTTAAGTTTCCCCCTACTGTTACTCAAGTATGTGAAATGTTGTGCAATGCTAA
GAATAATAATAAAAAAGGCTGTTGTTTTTTTCCAGATCTTTCAATTACCCAAATCGGCTG
CCCGGTGTAATGTGTAGACGTGTCATATTATGATTTAGATGTTTATTGGTCCCAGCATTG
GCCCACGTGGCACTCAAACATTCTAGCTGTTTCTCTGCTGGGTGCTTGCATGTTCTGTTG
CATTACATGAAGATTCTCTGCTTGATTGATTGCCATGATGTTTTTGAAAGCTGCAAATGA
TATCATTTATGATCTCGCAAATCTGTTTTTCATCATACGTATGTAATTGTGTTAAAAGCG
GTGATTGTGAAACAAGTGTTTTTCCATCAGCATTTCTTTTGTCACTCGCTAATCTGTCCT
GATGTAAGCCTCTTGGACAGGCATTAAGTGGAGATGAATCGCAGCTCTCTTCCTGACCAC
TGGCTGCCCTCATGCGTTAGTTTTAGTTTTCAGAGTAAATCTACTGTGCCATTATGCATT
TTATTGGCCTCTCAGATTGGATTTCTGCTGTAGCTGCTGTTTTGTGTTCAGATGAATGTG
ATGTGGCCTGTTTTAAATCAATCCAGCCACTGACACGTTCAACTAAAAGCTTAAATTAAA
GGCATGTCACTTAGATTTATGTGACTATTATGTTTGTCTTTTCCCATTGGGGTACTTTAA
AGTCAGCGTGAATTAAAATTTACTTGGCACATTTATGATCTTGTGTACAGTTGCTAAACA
ATAGCCAGATGACTTTTAATTTTTGCTTATATATTTGTCTTTTTGACTTCTTTCAGTCAA
ATCCAATTTTCATTGTGTAATTCCGTTTTGAAATATTGAATTTCTCTTTTAATTGTCACG
TTAAAGGGTAGTTTGCCCAAAAATAATAATGTAATGACTATTTGCTCACCTTTCATGTGT
TGACAAACTTTTGAGTTTTGTTCTGTTGAACACAAAAATATGTTCTTAAGAAAATCCATT
TAAATCCAGTGTTTGTTTTTCCTACTATAAAAGTCAATGGTTAAAGGTTTCCCACTTCCT
ATCTAAAATATCTTTAGTATTCATTGTAAGAAACTCTTAACACTTTATAATCACACACTA
TGAATCATCTATTAAGCAAAGAGTGAAATCATTATTTAAGCATTAACTGTACATTAACAG
ATGTTCATAAGCATTTTATAACTGCACATACAAATGCTCTATTCTTGACTTGTAAACACA
TTTAAAATAAGCGATTGAATTGTACTTTCATACTTTACTGATTAATTTTTCATGACTAAA
TTAAGAATCACATTATTTACAAGTTATTTAAACACTGTAAAACACAATATTCAACTTAAT
CAAATGAAATGAGTGTAGTTGACTCAAAATTGACAGTAATTCTACTTATTTGAAAAGAGT
TTTAAACTCCGTGTTGAAGGCAATGAGTCAATTAAATACCTCATTATGCAATTGGATTCC
TTAAACGATTCGCCTCAACTTATTGGGTTTTACAGTACTCAATTGGTTTGAGTTCTCTTC
ATTTTTTGGGTTTTACTGTGCTCTAATTGCTTCGTTTACTCAAATAAATTAAATTTAAAG
TGCTTGTTAGGATTAGTTTTTGAACTTAAATGGTTTGTTGCAATCGATTTCCTGAAATGG
TGTAAGTTGCCTTAACATTTTGGGTTTTACAGTGTGTTTGGGTTTTTAAAGATCATACAG
AATGAGTTAGAAAATTAATAAGCTATTCAAATCAACATTTATATATAATTATTTATGCAT
ATACTAAGAGTTAATGTGTACATTAATAATTTCTTTAACACCACTTCGTCCAGTTTTGTG
ACCTAATCTAAAGTGTGGACTATTTATGCTTTAAAAGTCCCTAATAAATGACATTTAAAG
GCTTGGTATCCAGTGAACAATATCTTACCTAAAAAGTAAAATTACTGTAAAGTTTAAACA
TTGCTGAATAACAGGAGTCAAAATGTAACATTTAATTGGAGTAAACGACAACAACAGTAT
AATTAACAAAATATTATGATGTTATTTAGCTACGTTTAAACTGCACAGTAATTTTATTTT
AGTTAAGATTGCTAAGATTTGTCTTTCATTTGATTAGTTTCATTTGTGTTTCTTCAAATA
AATAGAAATGAAAACATGTTTGTTTCCTGTTTAGAATATAACAGCCTTGTCGTTTAAAAA
GGATTTATAAAGCATAAATAGTCCTCTCTTTAGATTAGGTCAAAAGCTGGATGAAGTTAA
TAAAGCGTTTATTAACATACAAATTAACTATTAAAATATGCCTGAAAAAAATATATATAT
GATAATTTAAATAGTTTATTAATCATTTAATTGTGCATTCTGAATAATCCTTAACCAGCA
ATTTTTTTTCAAATATTTGATTTGTAAATGATGCGTTGATTTAGTAATGAAGAAATGTTA
ATTAGTCAGCGCAATAGCGCCTCCTCTCTCTCCCCCCTCTCCCTCCCTCCTACTTTTCTT
CCTGTCTGAAGTACTGTACTGTTCACTTAAAGGCAAAAAAGGACAAAAAATAAATCTTTA
AAAAACAATAATAGTAATTAGCCATGAAAACAGTCATTAAGCACATTATATACTGTATGC
GTTCATAAGTCAAGAATAGAGGATTTGTATCTGCAGTTATAAACTGCTTACTAACATCTG
GTAGAGTTAATGCTTAACACATATTGAATTCACTATTTTCTAATGCTTAATAAATGATTA
ATATTGTGTAGTTAAGTGTTACACTCATTAATGTACAGTAGTAGACAATGGTGTTTGAGC
ATTCTGTAAGTTCGTCAAACCAACATTAGCATATTTTACTACTCAATGAAAAGAGGCTCG
TCTATTTCTGTTAAACATGTAACTAATTCTTTTTTAATTATTATGATAGATTTCTATGTT
TAAAAGGTCATAATACTTATACTTATATTTATATTAATTTATTTCTTATTCTGAGGGAGA
TATAAAACACACAAATGTTTCGGCTCAGTGTGTGAAACAATTTACTCACTCTGCCCTCTT
TTTCCAAAGTCAATCACATTATGTCATTAATTGAATTGCTACTCAACAATCCAATCTCAT
TTCGTTTCATATAGAGCTAGTAACATAAGGAATGTCTCCTCCACCTTTCAAAAGCATTAT
TTCCATATTTAGAGGCTTAATTTGTTCAGAGAATCGCATATAAAACTCCAGTGATTCCGG
AGATTTCCACGTTACCATGAGAGCTGTGTCATTATTTCAGTCTCTCTTCCTAGGCGTGGT
ATAGAAACCTCATTTCGCCACAACCAGCCTCATGTGCATCAATCACAGGATGCGAAGTTG
GCATAATGAACATAACATCTTTCTAATTGGTGTAGACTGCTCTTCAGGTTTATTTTGCTT
GTTGTTATGGAGGTATATGGCCCACTAAATGCTAAACTTTGACTTACGTGACCTCTGATC
ATTAATGAATTGAAGACTGTCTGGTTGTCCATGCAGTTGTTAATCTTACCAATGATGTAT
ATTTTTTTCTTTCCACCCATCTATCAGAGTTAATAGAGAATGTGAAGTTGATACACAAAC
CTGTGTCTTTGCAACCAAGAGGACTGATAAACAAGGGAAACTGGTGCTATATCAATGCTG
TATCCTTTCGTCTTTGCTCAAGTTGACTCCATTCTGTATTGGTCAAGTCTGCCTCGTCTT
TTGTTTATCCTCCCTTGACTCTGAGCTTTAGACCCTGCAGGCTCTGATTGCGTGTCCCCC
TATGTATCATCTGATGAAGTCTATCCCCCTTTTCAGCGAGACTCAGAGACCCTGCACATC
CACCCCCATGATGGATAACTTGTAAGTTTCAAGTGTTTTTTTTTTCTGCCCTTAATATTG
CCATGATACAATGTGTTTATATGAACAGGATGTGGAATAAGTCACAACATGACTTTTTAC
GGTCACACTTTACAATAAGGTTCATTATTTAACATGAACTAGTTACAAACTATACTTGTA
CAGCATTAATCATAGTTCAACATTTACTGATGTATTATTAACCTCCAAACCCATGCTTGT
TAACATTAGTTATGCTCCATGAGTTAAAGGTGCAGTAGGTGATCTGCCAAAATGCTAACC
GCTTAGCATATTATCTTTGGACGGCGGGGAAGGACTGTGATTCAAAGCCACGCCTCCTGA
AATCGAGAAAACGTGCACCATTTCACAACAGCAGACAACCCACTAGTTCATGTCATTGTC
CAGTTTAGATGGTGTTTGGCCAGTGGCGTGCGGGAATTACATTTATTACTAAGCCAAACT
TGCATGCTATTTCAGAGCAAATATTCAGAGTAGCATTGTAAACAGTATAGGAAGGCTGCC
ATTGTTCCAAAATGAACCAGTGTGAATATAAAAGCAACTTCAGCTTAAAGCAGGTTAGGC
GAAATAGTGCTATTTAATGATGTTTTGTTGTTAAACTAAATAAATCTACATTATCGATGC
TGTAAAAGGACCTTATGAATCAAAAAAATAGTCGCATCAATCTTACACCAGGAGATTTCA
GTGACTGAAGTAATTTATAACACAACACAATCTAACATAAGCTTAGCCTGACTAAAATAG
TTTTAAAATAGAACATTACCTGTCTAACAGTAATGCTTCAGCCATGGTGTTGTCCTCCCT
CCAGCATGCAAAAGTAACTCCAATTCTAATTCAATACTTTCAAAAGTTTTAGTTCAGCAT
TTGATTTTCACCGCGTCTGTGATCGTCTCGTGAACGCGTGGCGCTTATGCAGGCGGGCAT
GCGGGAATGGCAGATCTGCATAAACAAGATACGCAGAAGTCCAAATCTACATTTGCTGGC
AGACAGTTTGAACTACTTATCGGAATTATGAGAGATTTCGGCCTGATAATATTTAATTGG
ATAAACATTTTTTAGTTTTGTCTTACCCAGAATATAAAAATACATATAAACACATTTAGA
TCGTTTACTTTAATCATTACTATTGGACTCTGAAGAGACTTTCAACCAGCACAACAAAAC
ATGTTTCTGAAGACAATCACCTACTGCACCTTTAACAGAAACTAAGTGAACTGTTTTCAT
TAACTGACATGAACAAATGCTTTAGTAAATTTATTGTTAATGTTATTTAATGCATTTACT
AACGAACAAACAATGAGCAAATGCATTCTTATTGTAAAGCGTTACCAGTTTTGTACTTAT
GTCGTAGCAGCTTTTTGTTTTCAGTTTAATAACAATATTAACATGCTAGTAGACTGATTA
ATGGAAATATTTTGTTCTGTACAGTTTTTTTTTTTTTTTTTTTTTTTTTTGCTATCTAAA
AAAAATCGATAATGCCAAGAACTGCAATAAGGGGATGTGAATGTATTGGCCTTTAACAGC
TTTTCATAGCAAGTTAGTGTGTATTAATATATATATATATATATACTGTGTTTGCTAGAA
GAAGAAAAAGCATACAGCTGTTTTAAACTTGGCTCATCCAACCTGAAAGATAAAGCACTG
TATCTTTTGTTTTTACTGAAGTGTTATATAATGGGAAGCATCTGTTTGTATAATGATGCC
AAACTTGTTCATAATAAATGAATGGTCTTTTATTTTGGTTGGTCTCCAAGTTTTAAAATG
AGGTGGAAAAAACTATCCATCAAGTCAGATGGACTATCTTTTTATTTGAAATCTGTTGAC
CTGACTAGCTTAAACAATTCTGACTGACTGCAAATCAATCAACATAAGCTTATGCAAGAA
ACTGCAAATCACATCACATCTTACGATCTACTTTCCATGTTAATAAATTGCTGTAAACAT
TTGAAGTGCAGCAGCCCTTGATGCTAAAAGGATCCTGCTTTTTAAAGAGTCAGCCTGGTT
TATTGGCAGTTTTAAACATGCAATGAGTATTTTTGTGTGCCCCCTTAACTCTATGCATTT
TTTCTTGTAGTATTCGGCTTGTGAATGAGTTCAGCAATATGCCTGTCCCTTCAAAGGCTA
AACAGCAAGGTAATGTGTCCCTAGAGTTAAAAAAAAAAAAAACATCTTCCCAATCCACCT
TTCTGTACTTATACATTATCCTCTGCTTTACTTGTAGCTGCTGGAGAGAAGATTTTGAAA
GACCTTCGAGTGGGAGCTCCTTTTGAACCCACATACGTCTATAAACTCCTCACCCTCATC
AAATCAAGCCTATCGGAGAAGGTAAGCAGCACAAATACTGGAGCGTTTTCAGAAAAGCCT
GTTACTTGATAACGTCACAACACTGTTCCTAAAGGGACACATTTGAATGTTTCCTTCCAA
TGGACTTACAGGTCAAAAATGACTTGTGCACCATTTTAATAGTAAAACAAAACCTAAACA
TTGTTTTTTCATGTTGAAATTTGGTTCCTTTTTCTAAAATTACCCCAGTGTTAGAATGAG
GAATAATTTTCTATTTTCAAGAAGGCTGTACACATTTATGGTACAACGCTTGTCCTTTGG
GACCAACCATCTATAAAACCATTTTTACACCACAAACTATTGACGGACTCGAAATGACAA
CACACACTAACAGTAAGAATCTACTGCTTTACTTTTGTGAATACTGTTTTGCTAAATGTT
TTACACTTGTATAGGTACGTTAAGCACTAGAAAATAAACATTTTACTTTAGTCAAAAATG
AGTGTTGCTCACTGTCTAAACTTTGAAATACTCCACACGGATGAGAAAAACAAAACAGAC
ATTCAGACAGTTGTTGATGGAATTGAGGATTGAAGTTGAATTTACATTCTTTGTTAGAGG
TTTAGTGAAGGCAGGTAATTTTTGACCCGTTAGAGGAACAGCTATTAAAGAATTCTAAGA
CGACAGGAGGGTTAATATAAAGAGCAAAAAGAAAATGTACACAACCTGACAAAAGTCTTG
TCGTCAATCCCAGTTGTAAGAGCAACAAATAATGACTTGACCTGACAAGATGATCATTTG
GGTAAAATAGAAGAAGGTCTTTATTTTTATTTTTTTCCCCCTCCCTGATGAATCATCTGC
CGAACTGCATCCCAATAATCTCACACACTGCAGAAGACCTATTGGAATCCACATCTACCC
AATAATGTCATAAAAATCAGTCAAGTTTGGTGAAGGAAAAAACATGGTTTGGGGTTACAT
TCAGTGTAAGGGCGTGCAAGAGATCTGTAGAGTGGTTGGCAACATCAACAGCCTGAGGTA
TCTAGACATTTGTGCTGCCCATTACATTACTAACCACAAGAGAGGGCAAATTCTTCAGCA
GGATAGCGCTTCTTCTCATACTTCAGCCTCCATATTAAAGTTCCTGAAAGCAAAGAAGGT
CAAAATGCAGCAGGATTGGCCAGCCCAGTCACCAGAGATTAACATTGAGCATGAATGCTT
TCTTTGCCATTCCAGATGACTTTATTAATTAATTACGATTTTAAGTTATTATAGAACATA
TTTTATGTGGGTAAAATAAGCGTAATTTAGAGGCCCTTGATTTTCAAATAAGCCACTTCT
GATACCAAATGATGAACTAGAAATCAAGTTATTATTTGTGGTACTTAAAACTTAAACAGG
CGGCAACAGTTTTTTTTTCATGAAGGGCCAAATACCAAATATCATTGAGAGCCTTTGGCC
AAAGGTAAATATACCAAACTTTATTACATTAAAGTTACTATGGGTAATTTCCTAATTTAT
TCAATAGTATTTAAAAAAAAAAATAGAAAACATTACTTTTAAATGATATTAACTAATGCA
GTATAACATTTAAAATGAAAGCTTATTGCTCATATTTTTTATAACACAGTGGAGTTCAAT
GCTGAATACACTTGTCAAGCAGAATCTGCCTTTAACTTGAATTGCTCACCAAACTCTGCA
TTGTTGGGTGACAGTATGTACATTTAAACAAATCTGATAATCCCATTTAGTTGAAACATT
TAATTTCAGTTAACTTTTAACAATTAAACAACAAATAAACAGGTTGCATTAAATTTGACT
TGACAATTGCGAAACCATCCCCATCATTCTCCTTCTCCTCAGATGGGATGGCAGCCCAAA
TCAAAGGTTACCATGGGCCAACATGCCCCACAGGCCCTAGTTTGGGCATCTCTGATCTAG
ACTTTGTAATGGTTAGTTATAATTGGCACTGATAATTCTAGTAGCACAGAATGCATGTGC
TTTGGCTGCTGAGAGAAAGATCTTCTTGTTCAGTCTTAGTTAGTGTGCAGACAGATATAA
AAAGTCAGAGTCAGACACCTCTAATGAACACATCAAAGCTTAATGATAACGCAATTACAG
CATTCTTCAGCTGCTATTGAGCTTAATCTGTGAGCATAGAGTTTTCTGGATGTGGAAGAG
GACAGTCTGTACGAACAGTGCTCTCTTAAAAGACACATTCCCCTATTCAAGGGATACTGT
TGATGTTCCCAAAAAGTTTTTTGCAGCATTGGTATAGAGGTGCAGTGTTGCAGTGAACCC
CTTTAGTTCTTAAAATAACTTTACTTTTTTTTTTTTTTTTTTTTTCATTTGCACAGTGGG
TTAAGTAGTGATGTTAGTAGGTTTAGTGGGTATAGTAGTTGTAAGTTTAGAAGTAATAGG
TGTATCTGCATTGTAAAAAGCTCCATAACAAATAAATATGAATAACAAATGAACAGTATT
AGTATCTAAGTTTAGTCATCGTCTGTCTGGGTATTAATTTCGTTTTGAGAGGAAATTTGT
CTTGGGCAAAAAGGAGCTATAACATTGCTCTAAACAGATAGTATAAATAAATCAAACAAA
ACAATTAAAAACAAACAGTAAGAACATACATTGTTCACAGAATAAGACCGTATACAAGTA
CAAATATATAAAACACAGAACCCAGTCAGGTGCTAAGGTACTACAGGAACGGTGTTATTG
GTAGAGATCAACAGTTTTATCGAGGTAGGAACAAACGAAAGCTTCAGTCAATTAGTTTTA
CACATTGGCATTCTCAGTTTTTTCCTGATGGTAATGGCTGATATTCACTGAAAAAGGGAT
TTTTGGAACCAGCGCTAATACGTATTGCTCTTCTCATAACCGCCTGTTCATATAGGGTCT
GTATGGGCTCGTATTGTTTTATTCCTATAATTTCCATGGCTGTTTTTTGCATATGAACCA
ATTTATTTTTCAATTAAACAGACAGGTTTTTTCAAACCAGACTGTGTAGGGGTGTCAAAA
TTAATCGTTTCTTCGGTGCACTGCGATGCAGACGCGGACAATTCGGTATCGGTTCAGTAA
TAATCATAACCGGTTATTACTGGCGTCATTTACCTCATGCGCTCTGTCGCGAGGGAGGCG
ATCGCGAGTATTTACAACGCTCTAACTACTTAAAACTCAGAAACTGTGCACAATTTCACT
GTGTGTGTTTGCTGGATCAGTCTTTCACTGACATGTACAACAAAAGCCCCTATTTCACTG
AGATCGAGAGAATGAAAGTACTCCATTTCTCTCTCTCTCTCATTCTCACACACACAGTGG
CCCATTTGACCTGCTGGCGTGGCTTCTTCTTTTCTCGGCTGTTTTACAGCGTTACTTTTG
CATACAGAAAGGAGCGCGTGTCTGCAGAATTTTCTCCACCATGTCTATCATACATCAGCT
GTGAGATCGCCGCCTGCCGCTTATCACTATCACTTATCTGTGAAGAACGCAGCGCGCAGC
TGATTGAGGGTGTGACCAATCAAAGGGGTGTAGAACTAGACAAGGATCAGAAATTAAGCT
GGATATTTATATTTGTTTATATTATTTGCTAAATGTTCGTTTTGTTTTAAGTTACAGTTT
ATATATCTGACTGTTTGTATTAAATGACAAAATTGTATTAAAAATAATATATAAATATAA
ATATATTCATACATTTTAATACAAAAAATGCTGCTGTGAAGAAAATATAAAACTGTATGG
AAAGCACCGTCAATGCACCGTGATGCACCGAAATATCGAATTGAACCGAATCGATGGCTT
GATAATCGTAACCGAACCGTGAGACTAGTGTAGGTTCACAGCTCTAAGACTGTGATTCCA
CAGCGAATAAGACTCTCAAACATAGCTCGGTAAAAAACAAGCAAGATATTGCTACTCACC
AATCTCAGCCTTCTCAAAAAAATAAAGCCTCTGTTGTAGTTGTGTGCACAAGCTCTCAAT
GTGTGTTCTCCAACAAAAAACACTGTCCATATGGAACTCCGGTTATTTGTAAGATGTAAC
TTGCTGTATCACTGTTTCTTTAATAACCTTCAGAAACACTTTGTGGGTCAAGGACCATTT
CTTGTGTCTTTTTTACATTTAACACAAGACAATTCTTATCACACCGCTCAATGAAATGAT
TGATTTCACTGTGGCAGGATGATAGGTCCATGTCTTTGTATAAAAGACTTAAAATGGTAA
GAGTGAGCAGTCTAGAATTGCTAACTTTTAATAATGCTCTCGGTCTTTCTCAGGGTCGCC
AGGAAGATGCGGAGGAGTACCTTGGTTTCATTTTAAACGGACTGCACGAGGAAATGCTGG
CACTGAAGAAGCTGATCTCTCCACAGGAAGAGAGTATGTTCCCTCTGTTTTCAGGCTTTT
CACTGGAATCCTGCCCGCTATAGATTTATTAGCTTTCTAAATGCTTCAAACTTACAATAA
TTGTCTTTGTGTCTGGCCAGAAGCCCCCACACCAAATGGGCCCGAGTCTCAGCCTGGTGT
GGAGGAAGACCCTGCTGAGAAGGAAGAAGGCAGTGACGATGAGTGGGAACAGGTTGGGCC
CAGAAACAAAACCTCCATCACCCGGCAGGCAGATTTCATTCGCACTCCCATTACCGACAT
ATTCGGTGGCCATATCAGGTAGGTTGTAATAAATACACAGTCATTTTTAGGTACAGCAGT
GGTTCTCTGAATCCGTTTAGTCAGTGTATCAGCTTTAAGTTATGCAGAAGCCCACACAGA
TGACATTTAAATGTATAATTGGTTGATTCAATTTTACAGTTTATGTTTATCAGCTAACTT
CATGACCAGATTTGGCTCGAATTGCATCGAACCAGTTCATTCATTGATTTTAAATTAAAT
GTCAGGGTGTTAATGGTGCTTTATACAGCCATATTATATTTGCAGATATTTAAGAAACAT
GCCCTGTGGACATATTTATTAGAAAAACAACGCTACAGTCAGTGTATACCAATCAGAAAT
GTCTGTCTGTTTTGGTCTAACTCCGCCCACTGCCAGTTTACCCAATTATTATTTCAGCAC
CCTGGATTGCATTGGGGAAACCAGGATATTTAATTTCAGTCCTAATGTATGTGGATGTGA
CTGCCTGAGGACTTTAAAATTATATAATTATTCTACAAAAACCATCTTTTTTTAATTTCT
CTCCTAAAACTTTCATTTTAGATCTGTGGTGTACCAGCAGAGCTCAAAAGAGTCGGCCAC
CTTGCAGCCGTTCTTCACGCTGCAGCTGGACATCCAGTCTGAGAAGATCCGCACAGTCCA
GGAGGCTCTGGAGGTACTGGTGGCGCGGGAGTCCGTTCAGGGCTACACCACCAAGAGCAA
GCAAGAGGTGGGAATCATCAACACTTTACATGATCTACACACCGGCATGCACTTGTGAAT
TACACAGTAACTGTTGGCATAAAAAAAAACAATTGTATAAAATCTGCCTGTCTGCTTGCA
TTTTTAATTGTAAAATTCTATTATTCCTATTGACCCTTCTTAAACACTGTCCCCGCTTTT
TGTTGTCCGTCAAGCTTTCAGTATCAGCCATGTCGCTCTCCTAACAATTTGTACGCTCCC
CAGATAAATAATCAATTTTTGAAAAAGTCACACCAGTCTGCAATATGCATATGAGCAATA
TTCAGGATTTGAATATCAAGAACTTGAAATCTAGACTACAAGTGTAGTCACGGGAAGTTG
GGATAATTGTAATATAATTGGTGGCATCTTGAACAAGACAAAACTGCATCTATGAAATTA
TAAGAGAAAATAAAGGTAAACTATTTGTTTATCCAAGCCTGTAGTCTTTGGAGTCTCAAT
ATGGAGTCTGGAAGCCTAAGGTTATGAAGGCTTCAGTCTTGTCCTTGCTTTTTGCGTCGT
ATTGATTGACAGTTGATGGTTATCCGCACACATTAATGCATTCACCACTTTAACTTCTct
aggttattggaaaagattaaaggtcaattggtttaattgttctctaatatctacattgta
ggtttatggcttcgttaagttaaaaaaaatctcctgaaacttttatttaagtatttgtat
tttttactccataaaatacccatagaatcaggtagtccatgattgaccctttatggtttg
tgtcatgaatgttaatgaactctgacgtgctgctcttacgaactcagagcataatgtaca
ctgaacatggacaaatataaacccgatcagaaacctattttgcaaaccagatctgttgtg
gataaaagctaaattataattaaacttgacaatatagagtgaatgagatgtattgagttg
tattttgaagctgcagttaaagaaaacgcagccatgaattaacctctgcatgaacagatg
acctttatgcgcatcaaatgaaatggctgcttgtcgagtctggatgaatgacctaaagta
ggcatacatgcaaatgtgtagggcatgacccgtgagtctcatcacagtttttgtcctctg
attggcctgttttacacattgaatttacatgaaaacgaggaaacagtggtgtctgaggcc
cacagtatgcccatttccatataatgatcttctgttattagaagctttctgggtacctgc
tatgtgttacaagtcccaatggatcacatgttcattgtaatttttgttgatgttaatcgc
cattaaaactctaccctgatggaaattgaccggggcacagaatgttgacgttatcattgg
ctggatcgcctgtcaatcaaactgcccgtgaataggtcaattgtcacgttactcatattg
ttgatggtctgagatctcagatctgatactcaaatgaaatttaaactttggatttctttc
tatctttagATTGAGATCAGCCGAAGAGTGACCCTTGAAGAGCTTCCTCCAGTGCTGGTG
CTTCACCTCAAGAGATTTGTCTTCGAGAAGACTGGTGGATGTCAGAAACTGATCAAGACC
ATTGATTACCCCGTTGATCTGGAGATCAGCAAAGgtgcatgtttctttatttcttcactg
aaactactctgctaatatcatgtagctaataccaggttttaactagttaatacgaacaga
acaggaacagaccatccaggaggaaaaagccctgttttctgcatgccagtgtagctgctt
tcactcaatatcactttagaaacttcagtctattggattgttaaagtaggcaagtcatta
cttgtaatgcatctgctctcaattttgctccccacaaaaagaccaggtttccccattcaa
ttgaacctgactaaaataaacaaaagctcaaatgagggagcagcataatccctttactat
tgtgtaaggcttcatgctgatgaaagtagactacatgtctgacaagaaatactagcctgc
ttgttccgctggattctgttgaggtctaaaactctgcattcaactgattgaatgttgtca
tttgtattttgcctttcgttttccagcgcttgctctgagaactagcaagcctattgcaat
cgacagtgttgacaatttataaatctgctgccgtttattaaaacaattcatgattttcag
ATCTCTTGTCACCGGGTGTGAGAGGCAAAACTATGAAAGGCCAAAGAACCTACAGGCTCT
TTGCAGgtatgtgtttatttcttttgtgtgcatctttttttccttttagtttctttaaca
catgcataaaaggatcctcatctggtattatcagccaataagtagcctacacatcttgtt
gttgacttattaaaggattatctagctggaattttccgaggccaatatgtattgagtgct
aatgtctcttggtgactaacagctaaaagtagtccctcctgatcaacactaagatataga
taactgaagcatactgaagttgcgtgttagctgaaagtatagtgtcatttgtgctcaagt
tatcatacaactgaaaataaatacttaagaaaaggaaaaaactttatccctgtgactttc
atactaccttaaagaattggataagactgatgccagttgctgtacatattgacgcttaag
aattgcccccagctacacagcatggcgtagcatttcctggctagtaatttctcatctgga
cctaactcaaagttagattaatcctgtttatgagcttgcgtgacatgcatgtgcacatac
ttttattgtgtcttccagcaagacatgcttctccatctttccagcttcttccagtttctg
actagttaagtcttgtatttcttgtctcggcccacgcacacgattccctgacctgtttaa
atacacatgggcttcccttacgggagatgttcacctttttccccccatcttcaggagtga
tttgcttttaggtgtttattttcctaaggaaataaatggttctttgcttgtcaagaagta
gcctgtccagcaatccttagcaactgtcgccataccaataaatttccccgaagtctctct
tctgttgtttgaacatctggtacgggttgacaatagagacattattgtttctaaactttt
tttttaatttatagagcatgcaatctatttcacatttgctttaggtaagctttactagca
ggtaggtttaccaaagtaaaatacattttgcggtgttattgatgttagagggctatagga
tgttagagggctataggggaattaccaacctacatcatacatgacgtcacatgggttcaa
ccgtgcacattggttgcaaaaatagaccggttgcaatagcaaacattagaggtgtgaacc
tatactggtcctacggttcggttacgattatcatgccatcgattcggtttaattcgatat
cacggtgcattgacgatgctttccatatacaatcttatgttttaggggggaagctatagc
aagctgtttgtatagacacacagcaccacactgtctctcattcaaacacatacacaaaca
ttcacagcaccaaacaaacacacacacacacacacttaagcccttgcaacagggagagct
cgcgctggtcccttactgagagctccttccagcgcgagctctcctggctaaacacatatt
gcgagggcttaaacggagcagtgctcgtaatgtcgagcgaaaaaaaaaagaaagacagct
gtgaaacataaccagctttttctttttgtaggaaacacactttagatcttttagggtaag
aggtttttgagttattgccgtctataactgaatgtgtgtcaggaatattgaaaacaaaac
caactgaaccgtggttatttcgggcacccctctggatgtacagcgccctcagcatttgcc
tattgtgcctatcccaccagccgaccccgagttggctgagtgttgtaaatacccgcactc
gcctccctcgcaacagagcgcataggagataaatgacgtcagtacataaccggttatgat
tattactgaaccgataccgaattgttcgcgtctgcatcatggtgcaccgaagaaacaatt
aattttgacacccctagcaaacatgtcgtgttgtgcagtaggatgccaaaatcaaaagtg
ttataatgtaaaacgcagatgtctttggctaacagacatcataagagctgaatggagtga
ggacctaattaaaaactcttcagttctcatttcatatcaagtatgttcacgctttgctga
atcatacactttactagtttttgattgcagcaatgatttcatcacaaacggttaaatatg
gttaattaaactgcggacactgaatgctttgtcgaaattctgaaaggatatataacttat
ttgatttgacatagatctatttcagtgtcggctagacctaatatttatgaagagcctgat
tctgtctaatgaatgttcacaatatatagtacagcttaatttcctatttgaattctgaat
ttgttttaaaagggatgatcataatgcaagtgttgcataacgtgaagctggttcgcattg
ttttagacacaagtttgtcatcaaagttcgtcccaaatgtgaccaatctaatctggacaa
aagcatatcgatttatggacttcaatgatcacacaagttacgtaatgctggagtttgtga
ctgcttggctactgtaaaagatcaaactccacaggatttagctgcttggcgttgttcagc
aatatatttccagaaataggttgacggctaaatctgtttaacataattgatttgcatgct
gaatcctgtgtgttttcccgcagTCGTCTATCACCATGGGAACAGTGCCACGGGTGGCCA
CTACACTACAGATGTCTTCCACATCGGTCTGAACGGCTGGCTGCGCATTGATGACCAGGC
GGTGAAGATCATCAATCAGCATCAGGTGGTGAAGCAGACTGCAGAGCGCACTGCCTACCT
GCTGTACTACCGCCGCGTGGACCTGATGTAGAAACCATACGCATACAACACAAACACACA
TACACGTTTACATGCAGACACGCACACAATCTCACACACTCAACCACGTGTCTCAACAGG
AACACTGCCCGACTTCACAATTGTCCTTCTTCCCTCGACCCTGCTATTCCAGAGAGCCAG
CTTTTCCAATTTTTCTTTTCCGTTTTGGGAAGACGTATCTAAAGACTTTTTCTGTAACGG
TGTTTTCCCCCTCTGCACACGGTCTGGAGAAGCCGAGGGGAGAATTGTTAGCACTGCAGA
ACGCTCCAATTTGGAGAGACAGACCTGAATCACTGCAAATGTCCACAGCCTTTTTTGTTT
GACTGGCCAGAGTGTGGATCCCTGCTGAAAGGACTCAAACCAGGCTGATGGACTGCTGGA
GAAAATCATTGTTTCTTTGATTTTTGTTTAATCTACTTTTTAAAAATGGCATAGGAAAAA
AAAATATGAAGTGTTTTGCCTTTTAGCAAGAGGAGTTGTCGGCCTAATTTGCAGCAGTTA
AGTGGAGCCTGTTCAATTCTTGACTGAAGCATCAGTGGCCAACACCAGCAAGCTACCAAA
ATAATTTGTGAAAATCTCAATGTTTGGAGTTTGTCAACTCCACAAGCAAGACGCTCTACT
CCACCACCACCACCACACATCTCTTCCCCATTTCTCTCAATCCTTATGCTTGAGTCATGG
GAAATGAAAGCGGGAGGGGGGTAAAGAGTGCTGCAAGTGTGCTGAATTGCAAAACGACAA
AAAAAAAATTTGATTCGTTTGAGACCTTCAGTGTGATTTTTGGGTGTAGGATTAGACTAT
CTTACGATTTTAATGCGCTTTAGGATGTAAAAGATTACAAGCTTTGTGCACGCTCTAAAA
AAACAAGTCATTCGAAACAAACGAGAGAATATTTCCTGCAGATATTTAAGTTTTAAAAGT
ATTAAAAATAAATCTAAATCGACAGTCACTTGGGCAGCTCCCTGTAGGGGGGGGGGGGTT
GCGATTTGTTCTTTAGGCTTTCTATGTATTTTTCATGCTGGCAGGATACCAGTGATATCC
GAGACTCCATCATGAACCGATTTCTTTTTCGTCCCCTCGCACCATCCTTCATCAGTTCTG
TTCTGTGTGTTGTATGAATAAAAAGTGTATGCGCTGTATCCGCTGGCTTCCTCTCGATGT
CAGTAGAGCAGCAAGAACTGAGCCACTCCTGCCAATTTCCTCGAAAGGGAGCTGTTTTGA
GATACATCTAGCCTGCATCTCATTCTGTACGTTAGCCCGCTCCGAGCAGTCAGCCTGTCA
TGTACATGTTGAGGCTCCCTTTGCAGCTCTGAGGATGATATCCCAGAATGGGGCGCAAGA
TATGTCTCTTACTGCAGTCAATTGGCTGTGCTGAGATCAGCTCTGAAGCGCAAGCGCAGA
TGCGCACATAATCATGTTTGTTGCGTCTGTTTCAGAGACCTCGCATCATCAATATTATAC
CTGATTGTATTTAGTTGATTGTTTTCACTTCATTCCCTATTGGCTTTCGATTTCTGTTCT
ATTTAAATTGAGATGATTTTTTTTGAGAAGATTTGACCCGAGGTTAAAGCACAACAGTGA
ATAAAGTTATGTAAGTACTAtgcttgaccttatttcatttcatttgtttttttgcattta
aattcagtcctccctacccctttaaaaaataaataaataaataaatttgtgtatagagag
cttgcttggagcccagacaagatatgcaatttgtttagcattttcggcaggactttggag
gaaaatgtgacgttaaataacgttaagagtacaccacaaagccctctgagtaatatttac
tccattcagagtgttcggtccctccgtaattgaggtaatgttactcagcagcagagttaa
agtgttaataaagtgacgattgagcaagatttgatttacttaggctctttgactcgattt
tgatgatacttttccttgctatgacacgtataaagagagcaaatatgatcaaattaactg
atccggtattgattcttactgttaataagtataacttagcaaatgatctttaaataatgg
tttatggcttaaaattctgtgttttttcaagagaatggacctcaactatggttttattat
ttatttttactgaagtttgccctgcgcacttgcgttttttagttccttctttggtttggt
gcgtcaatcttatcgatgctattattcaaaaaaaggtaatgattcgcactcaattgcttc
gtactgtttttgtttttctcacattttacgggtgaataaaagacggacgtttcggcacaa
agcttacacacactgtcttttaatcacccgtaaaatgtaagaaaaataaaaacagtacga
agcaattgagtgcgaatcattaccttttcttattatttattttaaaacgcattgagcatc
tgatttactttaaagacacagacatcaagaatcagcgtatgcatctgaacaatggttaca
gtttgttttttgctgcagtgtttgctagaagcatacaacattcatccatagttcccaaga
tgcactgcaggaaaagaaagtcttcaccaccattgagacgcatatgctgattctttatgc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1329, 12443..12511, 14547..14592, 15804..16997, 24207..24298, 24391..24500, 26590..26648, 26737..26840, 31073..31172, 31280..31457, 32001..32166, 33669..33813, 34380..34445, 37043..38839
1309..1329, 12443..12511, 14547..14592, 15804..16997, 24207..24298, 24391..24500, 26590..26648, 26737..26840, 31073..31172, 31280..31457, 32001..32166, 33669..33813, 34380..34445, 37043..37230
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved