Danio_rerio Locus rps20
snOPY snoRNA Orthological Gene Database
Danio_rerio rps20
Danio_rerio
rps20
7
snoU54
3926..3994
6382
agaattaataattcttaaaattaatatattttaataaaaaatattttggttgtaataat
aacaatcaaattattaaccctggttaattaatcttggtttaaccaatctctatttgcagc
cctattttttatttgctaaaatgtcctgcccatcatcaccagccaacccctgcgaaatgc
tctctcttccgttctttttgtttattttttatttttttattaactcaatgccacaagaac
gagaggtattacatttcacatagtttctgaaagagaaaaaaacacatatgtatataaaaa
taaagcaaaattatatttacattaaattaaatgttttcagagcatttcatgttttctgtg
cttttttgttttgttatggttttaaaagatttacatatactagttattcacaaaatgggt
caagtttggtttacagtgagcccacttttttcttacgtatatggtattttcctaacagca
taaacaaattaaaaatatattgtcctttacagttcaagttctcattatcagaataaaaca
gtatatcaaataaaccaatttttatcttatactccatttttgttaataaacaatcttttt
aaaatatttttgagtaaatacagtgaaaaaaaacatgcaaacttgattctttttcttaac
cacaaaattcacacatatttaaaatattaagttcaaatctttctaaaacatgtttagctg
gataaattatatggagtattttgtacgacacttctttaattttgtgatttaagcaaaact
tatttgtcaacttccaacgtttaactcaagaaatattatcaaataatgaaagccaaaaat
gtcttgccaacgaagggagagcatttctcttccgttctggctgaagggttgacgtgatgt
tgttgtcacgcagtacccggatgaattcatataaatgcacgagcaggccctttatccctc
ctctttagcagaagcacagtgagctcgcgtggttcctggctCACCGCTGTTCGCCTTTCA
GCTGTTGATACGAATAAGTCGGTCAGGAATTTGCAGTCATGgtaatttaacgttttatca
aacattgtattaacaaagtttagcgttttgggtgattttctccgtctatttaataaccga
tttcgcgaacgcgcgacagaagctttgtgatggcatgtgtttcacaaagtctgccagtta
gctaaaagaacattattttattaaaaaaaacatgcaagttgctttattattattttatgt
ttgtcaatgatctccgactttaatgtgttgacgatttacgtttgtccaaatttgagttct
actattctctgaatgtaaacgttataacgaaggtctaaaacatgataatggaagctcttg
atataagcgtaatgtgcttaaactaagccatgaagtgacaaattaaagtaatgaacgtat
tcgaaaacgcggggcttgctttcactgtctacggaaacagtggagcacgatcatgtcaaa
ataagagtctcagtcgtttgagcttttgtaccgttaaagtgttcatatgcatgacgtctt
tgcacaagttcgctgtatttggcgaacagttaacttcatggctaaaccaacgaaccaaca
ttagtaaataaataaaaaaaataatttgatgtggtgcttttcaagagaaattaaatatac
agaaattaaataaaaatttactttaaagtggtttaaaacgtttattttgcttcgctgacc
actaaaaattattttaaagaccgttggaaagtgttatctgtagacttatgcagtagatca
gtggcatagaggtgaaattggttttatattcggatattccgacattctccttaacaattt
aagaaaagtatttgcaaattctaaatagtgaaatcatataagcagccaatagcccctttc
acacagtgataccggtaaatatccggaaagtttccggaacgactttaccggtatattcaa
aaaagcgctgttcacacaggcgaggacgttacggaatttttccggaaaagagcgttcaca
catccattccaaaataccggtaaattctgacatcattcaccacaaatgagctttaaacgg
ctacgcttgtatttgtaaacatttgcctaaattacaaactctgtggatgatcaatattgt
gaacaactttcgcaggatcactttcgcatgtcgagatgttcataatatgtgcgtgtgctg
gcgctcacaggcacacgcaaagcttgaaggtaaacaaacaacggcttatcataagcatct
catcgatgattatttacacagttggcataaagaagaacatataaacgtgatctgactaac
ttctagcagctaaatgtgtctgaaaaaatattcaaaggtttttattctcacaaaccgcgc
ggacgtaaatgcgtctgactgttgtaattggctaaagcagatgtctcacgtcagcacgtt
ctagacgtgcacgcgcttattacggtaatcttccttttgcgttcacacagcgcagcattc
cggcaaattgccggtaatgttacagcttctctttccggaaaatagccagaacgaatttac
cggtattttcaaaaaggacctgttcacacatacaacggaaaggtctgtatgtgtgaaagg
ggctaatgactatttaagtacaacattgttcacagtcaattagacaatagcccctttcac
acatacagacctttccggaaaattaccggcaattttccggaaaggttgtatgtgtgaaca
ggcccttttgaaaataccggtaaattcgttctggctattttccagaaagagaagttgtaa
cattatcggtaatttgccggaatgctgcgctgtgtgaatgcagaaggaagattgccgtaa
taagcacgtccacgtctagaacgtactgacgtgagacacctgctttagccagtcagaaca
gtcagacgcattcacgtgcgcgcggtttatgagaataaaagcctttgaatattttttcca
gacacctttagctgctagatgttagtcagataatgtttctgttccttcttaatgctgtgt
aaaaaattatcgataaaatgtttatgataattcgttgtttacctttaagctttgcgtgtg
cccgtgagcgcccatagcgccagcacacacgcatatcatgaacatctcgacatgcgaaag
tgtttccctatgttttcattagagttgtactcaatactgatccatccgaagagtttgtaa
tgtagtcaaatgtttacaaacacaagcgcagccgtttagaggtcatttctggttattgat
gtcagaatttaccggcattttgcgatggatgtgtgaatgctcttttccggaaaaattccg
taacgtcctcgtctgtgtgaaccgcgtttttttttaatatattctggtaaagtagttccg
gaaattttccggatatttaccggtatcgctgtgtgaaaggggcttttgttaatgttgttt
tgaagtcatccttgcatgctaattctgattgaatattcagagtaacatggtaaacaatat
agatacttctaattgaatgaatgtgtgcgaaatataaaacaaactttacctctatcattg
tctactgatttacagctttctttaaaatcttttaacaggtttagaagtgaagggagagta
aattacatatttcttctgaactatctttttaattgtggttccctgagtgattttacgatg
tcaaaccagcctttggattataagtttgtaaagtgagttttacaaaacactcctaacagt
atgtttgatttacagGCATTTAAAGACACTGGCAAGGCTCCCGTTGAAGCCGAGGTGGCC
ATTCACCGTATCAGGATCACTCTGACCAGCCGTAACGTCAAGTCTCTGGAAAAGGgtgtg
tttgtccttcatgtctactaaaccaatggctatgaggataaaattgtatgaacgacttaa
acatgagttatatcatacgctattctgagcccttttttttaatcaagttggtcattatgt
ctgaatacgcccttcttgacgtccttaaactttccctctttttttggggtagTGTGTGCT
GATTTGATCCGAGGTGCCAAGGAGAAGAGTCTTAAGGTGAAGGGGCCTGTGCGTATGCCT
ACCAAGgtgaatgccagtctttacatttttagtttaacaggttgcaatttaaaaactgtt
taaatatgcacatttctaagatgcttgtcaaattaagcctggcttacactctgacttaat
attcctatacacttgtggcccctatgttgctaagatctgttgtcaatgtcagactgtaca
ttaatcaaaatgcatgcaataagacttttctaaggatcacgtgtcccattatcccacatc
gtaaaactcagtttctggagggccccagctctgcacagttaagttccaactctatttaaa
cacacctgatcaagttgagtcctttaggcttgtatgaaattaaaaggttaaacattggtc
acactagagtttgagcttctgaaattctgtcatatggtgctgtgaaaaggggttggatta
gacattaaaaaaagcaagcgattggtccatgttttaaattcctgtccgcaaaggtcatgt
tttgatctttgattggtctcacgcagtcaagtgatgcgaaactttcatttccggtctggc
gcattcatgtgcatatgaatggaagtttatggggcgaaaagtctagtgtgaccgcagctt
aagtgtgttggagaagggttggaactaaactgtgcaggactgtggccctctaggaactga
gtttgacacccctccattaacctgtacctaactgcaaatgtaaaatctttagcattaatt
ttgcttgttacatgtcataaatttaagctgcaatcattggcttgaatgcatttggttttg
tgttaataagaggagaacgctaaacgaaagtgtttatagttatgtggaaatgtcaactta
acaaaaataataaacatatttaagtctaggattacaggaatcttttaggtttcacaaaaa
cggtctctgtccaaaatattgccaaaatcacagtgtgaggtttgtttgcgttttatgatt
gtcctaaatcctgtaatttctcatccccaaatcagACCCTCCGCATCACTACTCGCAAGA
CTCCTTGTGGTGAAGGTTCCAAGACCTGGGACAGATTCCAGATGAGGATCCACAAGCGCC
TCATCGATCTGCACAGTCCATCTGAGATCGTCAAGCAGATCACCAGCATCAGCATTGAGC
CTGGTGTTGAGGTGGAGGTCACAATTGCAGATGCTTAATTGCTGTCTGCACAATTAATCA
GCTTTGTATTTCACATCTGATTAATAAAATTGGAAGTTTTGGAtctctgtctgccctttt
tcttttccccactccagattgaatgtcacacttatttttgtcatctactccttgactatt
tttatggaaaacgatgtaaatctgaattaatctttcaaattgtaatttaaagttgatacc
aatattgcaattgtttaaagcctgatgtccagaaaaaaaaagatttttcttaaatgtagt
caacatttgaagtggactgaaagttgtcccaagacaaaactgggtcttctgttcttttag
ggcaactgtgatcatttttttctgatatgctgattaatgtagttctgaacatgcatgtca
gtcaatttgaaatactcttaaaaattagcagattagcatgaacatgcttattattgtaga
tctgagaaaattaataatgtttcagtttacatctataaaatgtgtatgtaagcaatatta
acagttgttttgcacaaacgggtataaggctaattcatgtggattaatgtaagcacggga
cattaattatatttgcagtctcaatatttgatcaaatattttatatgtactttgattaaa
aatgcaaagctcatatgcgggagaaaaaaaaaagtgaagatagcatgggtacctcaagcc
cttaaaacattaacttcactcgctactcttaggcttagtccgtgatttagtaggggtagc
cacaacagaataaatcatcaattactcaggcaaatattttctttgtggttaatgcttttc
caaccatggtgacttcagtgattttttttattatataattgaaatgttacataaatatga
ttatacaactaaaacatttgtgttgcaagtgatttgtttttgtttcaagcgtaatagaaa
agccctttcaggtaaaaaaaaaaaaaacaaaacgctcctgcaactattgatcgcaaaagt
gtgtttaaatgcacatcataaaagatgtcgcaggtgtgtaggatactacttaaggaaatg
attgtaaacaggtgtgccaaatt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 3795..3894, 4072..4145, 5135..5382
1058..1060, 3795..3894, 4072..4145, 5135..5317
NC_007118.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved