Danio_rerio Locus rps13
snOPY snoRNA Orthological Gene Database
Danio_rerio rps13
Danio_rerio
rps13
7
SNORA19
3350..3477
4638
GTTTTTTAATGAGAAGACAATTAAAGCACAAAATAACCAGGACAATTAACAAGACAAAA
AAATCTTTCTAACTCAAAATACAATGGCTTGAAATGAGAGAAGAATCCCCGAATCATTCA
TTCATTCATTTTGGCTTAGTTCCTTTATTAAGGAGGGATCGCCACAGCGGAATGAACCGC
CAACTTATCCAGCATATGTTTTACGAAGCGGATGCCCTTCCAGCTGCAACCCATCAGTAG
GAAATACCCATACACTCTCATTCACACACATACACTATGGCCAGTTTAGCTTACCCAATT
CACCTAGCTGTGGGAAAAAAACTTGTGGACCTGGAGGAAACCCACATCAACACGGGGAGA
ACATGCAGTCTCCACATAGAAATGCCAACTGACCCAGCCGAGGCTCGAACCAACGACCTT
CTTGCTGTGCGTCGACAGCGCTACCCACTGGGCTATACACCCTTCCCTGATTGATGATAG
GAAATCTAATTTCTGATTATATAATTGTATGATCATTAAGATTAAATTATGTAGATATGT
GGTCATATATGAAATATATTTATAAAAATATAGTCATAAAATAGTCAAAAAAATTTTGTG
TGAGAGAGAGTGAGAGAGAGAGAGAGAGATATCAGTATATTTGTATTTTCCCCCCTGAAA
AAAACCTGAAATGTAAGATGAAAATAAATAAGTAAATAAATAAATGTGAAAAATATATAG
CAAAACAACAATAAATCCGAATAAATAATGTATATAGCCTAATATATAAACATTTTGCGG
TACATCTGCATGCATATGAAAAGCAAAAAATAAAAAGGACACAATTTTAATGTTAAATTT
CTTAAACAACACAGAAGAAATAAATGAATTAATCAATGTTAAATAAAAATCTTAGAAATA
TATGAGATCAACAGACAGGAAGTAATATTTTACGTCACTTCCGGCGCCCTACTTCACTTC
CTCTCGGCCTTAGCTCGGTCTTTCTCTATCCTCGCTCTTAAAACCGCCATCATGGGTCGT
ATGCATGCTCCTGGGTAAATGTTTTATTTTACACTAAAAACACCTTTATTTATTCTCAAC
ACCGTCCTAAAACGCTGTTAACACTTTATAACATGGACCGAACCCGAAATTGTTATTTCA
TCGGAGCTAGAAAAGCGTTTTTGAGCAGTCGGAGTGATCCCACGTTCTCTTCCTCTGTGG
AGCGTGATGGCAGCACATGTTGTACGAGGCGCTGCAGGATGAACACATGAGAGAAACTCT
TAGTAATGGTTCTGTTAATTATGCCGTCGGGTCTGTGTTTTTACGGTTTGGGTATTTTGT
CGCTCAGATTTACATAACGCATGTTTATGTGCCAGATGTGTTTGTCGGTTCGGGCGGGTC
AGACCTCATACATTTAACGTTAAATCAATTATTTGTAGAAGTATCTAAATCTACACTAAT
GTTAATTTTTTTTACTCGGTTATTTTTTTTTCTCCTTTGTTCTTGAAGTTGTAACTTGTA
CGTGTATATACTTGTCTTAGTTTTTGTTGTCAGTTATTGTTTACTATGTAGTTTTTGTTG
ACAAGCTAACTTGGTGAAATTGTCATGTCTTCTAAATTAATGTTTCTTGTAGATCACATA
ATTCACATTTTGAATGTTTTATTATTTTTCAGCAAGGGCTTGTCCCAGTCGGCACTGCCC
TATAGGCGAAGTGTCCCCACAGTAAGTCTATTGACTCAAATTTTTTTTTCATCTGATTAA
TTGTTAATTGTCACAGCTGTAAAAATATCCCATTATTTTGTGTTTTAGTGGCTCAAATTG
ACATCTGATGATGTTAAAGAGCAAATCTTTAAACTGGCCAAGAAGGGTCTGACCCCCTCT
CAGATCGGTAAGTTCTGATTGACAATACAGGCCTTATAACAAAACAAAAGTTTGTATCTT
TTAGGATCAAGAATTTCAGTAATACATGTGTGCTGGTTTTACAAAGGACTTTCATTTATC
CTTTTATTGTTCATTTAAAAACTTATTGATGTGAAGTTGGTTTTATATTCCCACATCTGC
ACTTTCTCCTTAATTAATAGAATTCCAGAAAACTATTCTTTGCACACTAAGTAGGGAGAA
CATACTAGCAGTCAAAGACTATCAAAGAACAGCATTGTTCACGGTCCATGAAATAGTGCT
AATTAAGTTTTGAAGTCATACTTGCATGGCATTTTAGACCAAATATTCAAGTCTTGGAAG
TACTAGTTTCCCCGCAGCAGGGATCGACCAAACAGCTCAAATAGCCAAAATATAAATATT
ATTGAACTGAGGATAAGACAAAAATATCTGAATCTTGTTGTGCTTGCTCATTAAATGTTA
AGCCACATGCTGCAGCTTTAAACTGTGATATTATACTGGTATTGAGATGGGGCTCTCATC
TTTAAAGAAGAAAGGCTTGGACTTGGAAACTTGGACTTAGTTTCTGACAGTATGATAACC
TTGAATAAAAATCACGGTTCACGATTCATGGTTTGTGATTACTGCTCTAAAAAAAGTTCT
GTTTAAATGTCTTGCTAAGAAACCAAAACGTTTACCTAAATTGAACAATATACATTTTGT
TTTATGAAACAATGCTTTGGAACCATGAACATGTCTGGCTAATTAATAAACATAAATGAA
CTTCTATTATATTTGTTTCAAAATTACAGATTTCTTTACAATACATAAAAAAAAAAATTT
AATTTTACCTTAGAAACGGTATAACAGAAAATGGTTGCTGTTTCAAAACCTTGACTTTTT
CAAACCAAGGTTTTGGTTATAATCCCATGCCAAGCCACAACTCAAGTGGATTGGCTCATT
GCTTGATCTGATAAAAGTAAATCAAATCAGTGTATATGCCTGTTTTTATATTTGTATATA
GTCTGTGGAAGCCTGTGATGTCTGCACAGTTTTAAGTCAATGCTTTCTTTTCTTATTAGG
TGTGATCCTGAGGGATTCCCATGGTGTTGCTCAGGTGCGTTTCGTCACTGGCAACAAAAT
CCTTAGGATCCTAAAGTCCAAAGGCCTGGCCCCCGACCTGCCTGAGGATCTCTACCACCT
CATCAAGAAGGCTGTCGCTGTGAGGAAGCACTTGGAGAGGAACAGAAAGGTATCAAATCA
ACCATTCATAATAGATTGTGTTTTATTTTAGGAGATTTCTGGGAAAATGAGATCAGTACA
CTGCAGCAGTTTGTCTTGTGTTTTCACAGGACAAGGATGCCAAGTTCCGCCTGATTCTGG
TTGAGAGCAGAATCCACAGGCTTGCCCGCTACTACAAGACCAGGAGAGTACTTGCCCCCA
ACTGGAAGTAGTAAGTGTTTGCTGTTTTCAAACTAATCCACCTATGTTTAGTGCACATTT
CATTGTCCCATTCTTCCCATGTAAGAACTGAGATATTTCTTATGTGCTAGATAAACTCTG
GAGGTAAATTAGCAGTTTGGCTTCATTGTGCCTCACTGCCAGTCCCCTTCATACAATATT
GTCTTTTTTTTTTTTTTTTAATTACCTTTTACAACTTGTCTTGCTTAAATCTGTTTTCTG
ATTATTATTTGTTTGTTTTCTTCTACAGCGAATCCTCCACAGCTTCTGCATTGGTGGCAT
AAATTTGCAGTTTTTGGAGAAATAAAGATATTTGGATCACTTCATGTGTTTGTGGTGTTT
GTCTTAGTTGGGCACAGAACTGTAACGGGTCCAATATTTTCAATGGTCAAAAACAGTTTA
CGTATGCTACTGCTAAGAAAGTCGACCTTTTAAACATTTAATTTGCAATGAATCAACTGA
ATATTTACATGTGTGCATGTTCAATGAAATCAAATATATGGGTTAAAACGTTAACTTAAA
ATAGATATGTTTTACATCATGAAAGTGCATGTGCAAATAACATTTTATAATGCCATACTC
TTGGATTATTGGAAGTGTGTTGTTACTAAAATTAAGAATTAACATATTTGTTAAAGGAAA
TTTTCATCCAAAAATTAAACTCGTTATTCACTCATTTTCTTACAAATTCCTAAAACTTAG
ATCGGTAATCTTTGAATATTTGGATGAAATCTGAGGTTTCCAAAGGTTTTTAATGGGTCA
ACTAACTTTTGGGAAGGCATGGGAATACTTTTGTGCGTGCGAAAACAACGTTTTATTTCA
GTGTGCGTTCACTGTACGCGTTCACGAGAGTGCTGCCTCTGACGTGTGCCCCCTAGATGC
GGCCGCGCTTTGTTTCAAACAGGTGCGCTTAATTATCCGGACAGTGCAAAGAAAAAGTCC
TTTGGTAACTTTATAACTGCAGTTGAACACATACCTCGTGGACTCTTTGGTATCTGTTCG
TTACCTTTCTGGACTTTTAACATTCGATATCTGTGCATGGATGGTCAGAAGGATCTCGGA
TTCCATCCCAAGCATCCGAAGCGGATGAAGGCATCGAGGGTTTGTAACGACTTGAAGGCA
AGTAGTTCATTTATTTTTTGTGATCTATCTTTGAATTGCTAAAGATGATGATAAATGGCA
AGTGTGTCCATTGTTGCAGTGCAAAGCTATGAAAATATTAGTCATGGACGAAGTTCACAA
AGTGGTTGAAGATGACAATTAAACGGCACGAAAAACACTAGCACAAGGTTGTGACTTGTG
AGACAATAGTTTGTCTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1652..1700, 1788..1866, 2939..3108, 3209..3309, 3568..3638
1011..1033, 1652..1700, 1788..1866, 2939..3108, 3209..3309, 3568..3601
NC_007118.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved