Danio_rerio Locus eif4a1a
snOPY snoRNA Orthological Gene Database
Danio_rerio eif4a1a
Danio_rerio
eif4a1a
7
SNORD10
5130..5268
9558
CTTGACTGAGACACCGGAGGTTATTAACAGTTGACTGTCAGGCAGGCCCTTGTGTGTTG
CTGCCTGAGTCAAACATTCTGTGTTGGGTTTCATTTTTTTGTTCTGCGCATAAAGTTGTT
GCAAAACTCCTAATCAGAAATGTTGGCATGAGAGTAACTGTGCTAAAATGCAAGTAACAA
ATCATGTCTGCCGTTTTGTTTTTAATAAATCATCATGCGAAAATAATAATTGATGCATTC
ATCAAGAATTACATGCTTTTTTTTGTCACTTATATAGCCCAATTTGTTATGATGGGTTAC
TGAATCACCACACGGTTTACTTTGTACTGTGCTCATCCTTTCTTAAACTGGTAGTTATAC
CAGTAAGCTGTTTTAAGCCTTCATATTTGTAAGAACTGTTAAATGGGAACAACAGCTGTG
AATCATAAATGACTCACTTTCGACATTTATGCAGAGGAAGACAAGACATTGGGCAATAAG
GGAGGGTTGTCCTGTACTATCTTAAAGTCAGCAGCAAATTATTTGACCCAGTAACATTTT
ACATTTGAATGCTGTCAGAACCATTTTGAAACATTTCAACAGCGAGTGGCATAAATAGTA
AAGGTACTCAAATAAGTATGTCCATTTAAACCCATCATAAAAACAAACAGGTCTTCGTAT
TGTCATTTACTTACGTTAGCATATTCTATAAAGAAATGGACTCAAAATGTTTTCGACGAA
AACCTGTAATTTGTGCTATTTTTTTATACGTGTAGTTGGTTTACATCATTAAAAAGGTAT
TTACCATTTAGAAAGTATCTTTCTAAGCATCACATTTCCTATGAAATTTGTTTTAAGTTC
CAGTTAGGATTTTTCCCCATTTCGTGACGTCTATGAATAGGCGCTTATGATAGGGCGGTG
CCAATCGTTAACTAACCAATGAGAGTTGTTACTGGGCGGGACTACAGGCTGACTGAACGG
GAAGACGTCCAATCAATGGACTTTGAACATCGTCACGGTTTAAGTATTTGCGCGTTTCCG
CCAGTCTACAGTCCTTTGTAATAATGTCGTCTGAACATGAAGATAGGTAAGATAACGTGT
TCGACGAATGTTTCTTCTATCTGTTAAAATATTGATTATTTATGGAAAACAATTAATTCT
TATCGATTTAAGATGTATTGTAGTAAAAGATTGTTCATCAGCGGTTTAAAAACTAGCATT
ATCTGCCGATTTGGCATGTTCGTGCTCGCCCTGTTCCCGCCTCGTTAAAATCGTTTAGAA
AAGTGTGTTTTTAATCCAGTTTCCTGCGATATTGTCGTTTTATTTTAGGATATCGTATTG
ATGTTAACTAAAAAGTGTTTTAAGATGAATTGGTGCCATATTTTCGATGTTCCGTTAAAA
TGCCGGTTCTTGTGACGCAACGTGTCTCACGCGCTGCTTCAGTACATCGTGTGACCGGCG
CGTCCATGCGGCACATGGCCGTTTCATTTCCCTCGTTTTGAACCGATTGCGGACATTTTC
AACATTCATTGTTATGTACTCTACTCGAGAACATTGTTTCGGATGCCATCCATTATTAGA
ACCGACTTTGTTGGCAGATTTAAGCCCTCAATCGAGAGGATATGTATGGCACATGGCCTT
TCATGGGCGAGACAATGGAGTGTGGTCTGGGAGTATAACGTTAGGCCTAACGTCAAGGCC
TGTTTTCAACCATTTCAAACCAACTATTTTCTAAGATTAAAATTTTAGAACGTTAAAGGG
TGGTATTTTTATGGATTTAAAAAGAGGCGAAGCGGTGTCGTTGTTTAATATGTAACTTGA
TATACTGTAACTTCATAATCGAGAAACATGCGTGTTAATTAAATGGTATATCAATCTGCG
TGGTTATGCTGTTTCGTGACGTTTTTTATAAGATTGGATGTTGTAGTAATAGATTAATGT
TGAATATATGCGAATGAATGTGTCTCGGTGGAGCCACGTTGGTAATGGCGCTGAGCGAAA
ATGGCTGCCTCTTGGTAACGTAGATTTCAGAGGTTGCTATATCAGTGTCTTTAAGAAGTT
CTGTCTCAGTTTAACTAAACGATAATGAACATCGAAAAACAAACCTGTCGGACCCATTTG
TATAAAAAGTAATGTTAGGTGGAGTGACAGTCTCCGTCACCGTTACTTTCAGTATGTGGG
AAATAACGCAATGAAAGTGAATAGAGATTGACTGTGACTATGCCTCAAAGTCTGAGCGCT
TTTTTGGGGGGGGGGGGTGGGTTTATATATATATATATATATATATATATATAATTAAAC
ATACATGCATACATTCTATGCAGTAGTAAAGTTCAGTTAATGTGTCCTTTGGAGATGTTC
AGATTTTGGCACTGAGAAATAAATTTTGCGAAATGAGTTGTCAAAGTACTAATTACAACC
TCTTATTGCAGACCCAGAGACAATGGCCCGGAGGGGATGGAGCCAGATGGAGTCATTGAG
GTTGGTGTCTCTTAAGAGCCATTTCACCTAAAGTATTTATAACCACAATATTGTATACGT
CTTGGTGTCTATGGATAGCAGGAATCACTATAGAATAAAGGTAGTAATTAGATACAGATA
TTACATATAACTAAACATAGTGGGTCATGAATGCCTTATCTTTGATCTGTCCACAAATTT
AAATGTAAAATCAGGGCTTCATGTTATTTCGAGGCGGTTATACAATTTATAGAAGCTACA
GAAGTCCATATATACTCAAATCTTTTTTTTTTTTTTGCAATGAAAATCATAGAATACTTA
ACAAAACATTATGCAACCCTGAAATAAAGTAATAAAATAGTTACTTGTAAGCTATTTATA
TTCAGGTGCAAAAAATGAGTTGTCGTGTGTTAATAATCAACTATAAATCACATTTATTTT
ACAGAGCAACTGGAAGGAGATTGTTGATAGTTTTGATGATATGAACCTGCGAGAGGCACT
TCTCAGAGGAATCTATGCTTATGGTTTTGAGAAACCTTCCGCCATTCAGCAAAGGGCAAT
CCTCCCTTGTATCAAGGGTATGTAGAAATGTAACTATCCATCTATATTTGCTTGGCACAT
TTACTTGAACGAAAATATTTGTTTATTCACGCCCTTATCATCTGGGCAAGGCTGTGTCTG
TCAGTGACACTCTGACCTATATCTGGTAAGGGCAGAGGAAATAAAGCCCATATTCATCCC
AGTCATCTCAATACAGTGAGGCATAGACTGTTTCATGGTATGGGCACAAACTGCCTCGGC
ATACTCCTTGAAGGCTTTAGTGAGTAACCGACTGTGAAACACCAAATAATAATAATTAAT
ATTCTCTCTATAGGTTATGATGTCATTGCACAGGCTCAGTCCGGCACAGGAAAGACTGCC
ACGTTTGCCATCTCCATCCTGCAGCAGATTGATGTGGAGCTGAAGGCCACACAAGCTATG
GTTCTGGCACCTACCAGAGAGCTGGCCCAACAGGTGCGAACCATTTCACATTCAACACTA
GGGACACAAGATAAAGTCTTGCAAATGTTTCAGTTTTATACACGTGTCCCCTATCATCTG
GGCAAAGCTGTGCCTGCCAGTGGCACAAAGCTTATATCTGTTAGGGGCAGAGGAAATAAA
GGCCATATTCATCCCAGTCGGCTCAACGTAGTGAGAAAAAGACTGTTTCATGCTATGGGC
ACAGATACTTGTCTTAACTTGACTCATGAGCTCAGCTAGTTTCAGATGCAATGAATGTTA
AATGGGATTGATCTCTCAAGCTGATGCAGAACTCTCTTCTGTTCTCCTCAGATTCAGAAG
GTGGTCTTGGCTCTTGGAGACTACATGGGGGCAACTTGCCATGCCTGCATTGGGGGTACC
AATGTTCGTAATGATGTTCAGAAGCTTCAAGCTGATGTGCCCCACATAGTGGTCGGAACC
CCTGGCCGTGTGTTTGACATGCTCAACCGCAGATATCTCTGTAAGTACTTGATTTGGTTC
ATCTTGATTTCAAGTCTAATTCTAGAATTTGAGTTTTGTTCTTTTTTTTAATTCTTTTTT
AATTGGCTAATTTGCGTTTTTTTCTTTCACCTCTCCTCCAGCTCCTAAATATATAAAGAT
GTTTGCCCTGGATGAGGCAGATGAAATGTTAAGTCGTGGTTTCAAGGACCAAATCTATGA
AATTTTTCAGAAGTTGGCCACAGACACTCAGGTAAACAAGTCTATATTTTGTGTGCATCC
ACGCCAAAGTTCCCTCACCTGCCAGCGCTCTGTGCTGTGATGGGTATCAAGTTCTTTGGT
AGAGTGAAGTAACTGCTCTCCACTATGATTGGGCTCTTCAGTCCCTCTTCATAACTATTT
AAGCAGCTGACATTTAATTTAAAAAAAATATTTGTTTTACTTTTTACTTCATAAAGGAAA
TCCAACCTGAAGTTTCACACAGAATTGTAAGACATTTTAAGAATCGATTTGATCAAGTAG
TTCTTACCAGATGTCGTATTGGGCATACAAGAATAACACATGGTTTTTTGCTCCAAGGTG
AAAACCCTACTCAGTGTTTGTGCTGCAAAACTCCTCTTACTGTAAAACATAATTTACTGG
ACTGTCCTGCTTCTACTGATTCCAGAAAGACTTTTTATGAAATGAACTCTTTTAAGGACA
TTTTTGACAGTGAAACCAGAAAAGATTTTAGAATTTTTATCATGTATTAACACAAATCTT
ATTTTATTTATGTTTTATTTTGTTTGTTGATTTTTAAATTGTATATTTATTGTTGAAAGA
TTCCTGCCATGAAGATAGCCTTGGTTGCTGACATGGCACTAAATAAAAAAAAAAAAAAAA
CATGCTTATTAAAGGTTTGAATATGGCTGCTTTTTGCTTTGATCAGTCCAACTATTAATC
TTTATGGTCTCAATTTATTTTGAGGCTGAACCTAATAGAGGGTCTTACCTTTTTTCACAG
GTGATTCTTCTGTCTGCCACCATGCCTCAGGAGGTGCTGGAGGTGACTACAAAGTTCATG
AGGGATCCCGTTCGTATCCTAGTTAAGAAAGAAGAGCTGACCCTTGAGGGTATCCGGCAG
TTCTACATTAATGTTGAGAAGGAGGTGAGTTGAGAGGAATGTGAGCTGTCATGTCTATGG
TTTGCAGTGATTAGTGACAGTTATAAGGCTGTTTTGTGATGATCCCCATGCGTGTCAACT
GATCCCAGACTCCCTGCAGTGCTCAATGTCTGATGAGCGTTTTGCTCAACAGTGCATTTT
GAGCCTGTAGGACTCTGGGAACTTGATCTTAACTTTTAAATCTGAAAACGGCACTACTTA
GTGGTTAATCTTAAATATAATTCAATTAAAAGAAAAGTATCCTTTTACAGAGCAGTTTTC
TCTGTATTACAGGAGTGGAAGTTGGACACATTGTGTGACCTTTACGAAACCCTGACCATC
ACTCAGGCTGTAATCTTCATCAACACTCGCCGGAAGGTGGACTGGCTAACTGAGAAAATG
CACGCAAGGGACTTTACCGTTTCTGCTCTGGTAAGTGAAAGGTTTTCTCGAATGAGGATT
TTCAAAACCTGGTCAAAAACACTCAAGCAAACCCCTTCAGTCATTTTTAAAATGTACTTC
CTGAATACACCAAAGTTCCCTCACCTGCCAGCGCTCTGTGCTGTGATGGGTATCAAGTTC
TTTGGTAGAGTAAAGAAGCTGCTCTCCACAATGATTGGGCTCTTCAGTCCCTCTTCATAA
CTAATTAAGCAGATGACATTTTCATATCATGATTAGGCTTTTTACTTGAAATAGACTCTC
TACACGTTATTGGGTGGGTCATTTATAACTGATGGTGTTGTATTTAATTTATTTGGATCA
TAGTTCGGTGAGACACCTCTTCCTTTAGTGGTTTAAACTGTCTTTTGGCCACTTTCCTGT
TTTCTGAGGTTATGATCTATGGATGGGTTAGTGTATGAACTTTATTTTTTTTTTTTAATC
CTTTCAGTCAATGTTACAATGTAAGCTTGCAGCGTTGACCATATAAATATAAGCAAGCAG
ACGATGGGAAAAGATCCAGAGAGGGATCATGTTTGTTGTTCTTTTGACATCTTAATTATA
CCAGTGCTGTAAGCTTTTTGAGTTAGACTGGTAAGAATGCGAGTTATCTACAATGGTTCA
GCTCAACATTTTAAACCCTGTCGACCAGTGTATTTAGTGGTTGACTTAATGAATAGGATT
TCTAAATTAATCTTGATGGCTGTAATCTGAGACCTCCGTTTCAAAACATAGCTGATATGG
TCTTCCATCTGTTCACTGTCATCCGTTCAACTGTTTACATTTAATGACCATTTTCATGCT
GCTCATAAATTCCTTTTTATGACTTTCCACTTTCTTTGACTTCATAGCATGGTGACATGG
AGCAGAAGGAGAGAGATGTCATCATGAAAGAGTTTCGTTCCGGCTCCAGCCGAGTGCTTA
TCACCACTGATCTGCTGGTAAGCAAATCTACACACTAAGCTTTCACATCCAAAGATCCCT
CTTCCACCAGTAATCAGTGCTGTGATGGAGATCATGTTCTTTGGGAGATTATTGAAACTG
CTCCCACAGTGACGGGGTCTCAAAATCCCTTAACACTAATATAAGCAGTTGACATTCACA
CTTTTCAAGCACAATGGCTTTAATCTTTCAGAAAAGGTGTATACATTAATTAGTGCACCT
ACGTTCTTGATCTAAATCATTGGTCACTTTCATCTATACATTTGCTTTGAAATCATCTAC
CACAAGGACTTTCCAAACAAGATTTATCACTCAAATGTATAGTTCTGTCTATAATGTGCT
CGCCAGATCCTCAAGCAATCACAAATACTGATTCTCAAAGGCAATCACAAAGGTCTGATT
TTTGTATATGTTATCTTCAGGCAAGAGGCATTGATGTACAGCAGGTTTCCCTGGTCATTA
ACTATGACCTTCCAACCAACAGAGAGAACTATATCCATCGGTAAGTGCTTGGCTTTTCTT
TGTTTAATTTTGTGTGTATGTGTGCTAACAGTGTTTTATATTTGTGCAGAATTGGTCGTG
GTGGTCGTTTCGGCAGAAAAGGTGTCGCTATCAACATGATCACTGAGGATGACAAGCGCA
CGCTCCGGGACATCGAGACCTTCTACAACACCACTGTGGAGGAAATGCCCATGAACGTTG
CTGATCTGATCTAAGACACCTGACTTTTTTTTCTCCTTTTTTCCTCCTCCCCTCTTTCCC
CTTTTTGTTTGTTTGTTTTTTTTTCTTCTCTCCTGTCTCCTTTTCTCCCCTTCCCTCTTT
AGTCTCATTCCAACCCACATCCCTGTTCAAGCAACCCCTCACAAATCAAGTACTGTCAGT
TCTGAGGGTGTGAACCTTTTATAAATCCAGTGTGTTGGTCACATCACTGAATACTCCATT
ATTCAGACATTCAGAATATCCATATTATAAGGCTCATTTAATCTTGCCCCTTTTGAGTGG
TGCCATCTACTGATCAAGAGGAGGTGTTGCAGGGCTTCTTTGCATGCGTGGTGTAAATGT
TAATGCACTGACTGATATATTGGATTGGACACATGCCCTGCTTGTCTTGATAGTGTTGGT
TTAACCATTTTTTGAGATGTGACTGTTTACATAGGATTTGCTTTTTTGTAACACAGGGCA
AAGGATGTAAAATACAGAATAATTCATGTGTTATATGGGGGACTTGGACATATTCCAAAT
TGCCATTCACTGCCATTTTTCTTTTAACAGAAGCATCAGCTAAAAGAAAGATGCTTTTGG
TCGAAAGGAAGTTGGTTTGTGGGAGCAAACCAGATTGTAAAATTACTAAATGTGGTCAAG
TCATTTTCTCCAGCGGTCCAATTCTTCTGTTACATCTCTTGTGTTGTCCTGTGTGCGTGG
CTGTAGCTCTTTGATTTTTGTAAATAGGCTTTACTCTGGCGGGGCGGGTGGTTGAAGGCA
TTAGAAATGGGTTTGTATGATTGGTGAATGACCCACCATTGTATTGCCTCAGAATTTTTT
CTCTGCATCAAAGTCCTATTGGGGAGTGTTGCTCCTGTAACCTACCTCACCAAACTGTTG
GAGGGGTCTAAATATGTAAGGACCAAACTGCAGTAGTAGAGTATATAGAGATCATTATGT
CTTCGTATTGTTCAAAAAATGCCTGTCTTTGTTGGGTGGGTTTGGATGTGGGGGTTTACA
TTGGTCAGTGCTATTTTTTTAAAACAAATTTATTACAAATGTGATAATTATTAACCTTTT
TGAGACAGAAGCCATGTATTAAATCTTTTCTACATTGGACTCTGTATAGTATTTATTTTA
ATGGTCTGAAATAAAGGTATTTCCCATTTTTAACATGCTAAGCTGCCTCTCAATCGTTCA
TTATGGGCTTCATTTGCAATAAATCAACTGTTGGATCTTGTAAAATACAAACGTCAAAGG
CCTTTTTTTTGTTGCTGTTTTTTTGTTCTGTGGGTGTGATGGGAGAAACTAGTCTTCAGT
AAAAGGATCGTTTCTCAGTGATCACGAGAATGGTGTGTACAGTTATTTGAGATTCAATAT
TTTAAATATAAATACAATAAAAACAATTCTGTCTAGTTATTGTCGTGCACTGTTATGTAT
GTTTATAATCCTATATTCACTTTGTAACCCTGTACCGCAAAACAAGTGTTTGGAATTTAA
AATGTGTACATCTGAAAGCTGAATAAATAAGCTTGCCATGACGTATGTATGTTAGACTAG
GACAGTAGTGGGTGGGGATACAGATGTTTGATAATCTGTAATCTAAGGAGTTTTTAAAAA
ATATTGAGAATCTCATTTCAACTTTTCTACATTAAAGTTGATCAAAATGCACATTAATAT
TAAAATGGGGATATATATATATATATATATATATTTATTTATTTTGTTTTTTTAAATAAA
TTAAAAATGCCAAAAATGTATTTATATGCTACAATGTATTTTTGGCTGTTTACAAAATAC
ACCTGTGCTACATCAGTCTTCAGTGTCAACCGTGAACCGGATGTGACCTGTTTGACAGAA
GGTAGACATGCCTCCAAATGGAAAATATAACGTGAAAATCTCAGTAAGTTGCAACAGTTG
ATCAAATACTGATTGGAAAGAAATGTTTGTTGATAAAATTATATAAGTCAAATTTAACTC
GTATTATGGTTAAACTTGTTAATTCGACTGTAATTTAAGTCTTAACATGGCGCTGCCCGG
AACGTGTCTTTCCAACGCCGTGCACATTTATTTTACCTAAGGAAATGAAAGAAAATAGAA
ATTTGCTTATTTTTCTGTTAAATTTTGTCTGAAGCTCTGAAAATTATTAATTTGTTACAC
CCAAAATGTGTAATTCTGTCACCCTGCAGCCCAAGCTGAGCAAGGCTAAGCCTGGTTGGT
ATCTGGCTGGTAGACCCAACACTCACCGGCCACTTTATCAGGTACACTTTACTAGTAGGC
TACCGGATTAGACCCACTTTTGCTTTCAGAACTGCCTTAATCCTTCATGTCATAGATTCA
ACAAGGTATTAGAAATATTCCGGTAACACTTTACAATGACAGTAAACATTACTTTATTAT
GAATTAATGAAGGCGCGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 2411..2457, 2882..3016, 3313..3452, 3771..3939, 4061..4170, 4920..5063, 5352..5489, 6347..6436, 6860..6939, 7009..8558
1043..1065, 2411..2457, 2882..3016, 3313..3452, 3771..3939, 4061..4170, 4920..5063, 5352..5489, 6347..6436, 6860..6939, 7009..7153
NC_007118.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved