Danio_rerio Locus ranbp1
snOPY snoRNA Orthological Gene Database
Danio_rerio ranbp1
Danio_rerio
ranbp1
5
SNORA77
6883..7011
9956
AACAAATATGTGACAGTATAGTAAAATAATGCCAGGGTGATAGAAAGTAAATAATAACA
ACAATACACACACAAAATAGACACTCTATCTTGTTCATTTTTTGAAATGACAACACCTAA
ATAGTTAACAGCTTCTTCAACTGGTATACCTTCTACAGATAATAGGGGAGAATTTTTATA
TTTCACAATTTATGAGGAGATTAGGTGCAAACATCAGGCATTAGAGAACAACTGAATAGA
TTTGATAACCTGATGAACCTGGTTTGAGTCTTTTACAAATAAGGCTGTATCGTCTGCTTA
CTGACTAATTAAAACATTTCGTCTAGCAATTTGGATTCTAGTGACAGAAGGCTTGGGCTA
CTATGAGAAACAGGTACACAGAGGCTGGACAGCCTTGCCGAATTCCTCTTTCTAATAGAA
ATCTCTGTGTAGTTCAATGTCCTCATTTCACTGAGCTATTTCCCCCGTCATACAGCGTAC
TCATCCCCTTACAAAAGAAGGGCCCAAAACCGAATTTCTCTAAACATGTATTTAACAGCA
CTTTTTATTTATTTATTAAAGAATGCTAATATTCAACCACAATCAGGAGACTGATATGAG
AGAGATACAAAGGAGAGAAAAAAATACAAACTACCTAAGCTGAAGAAAGAAAAAAGAATA
ACAAAACAAAGTAAATTACAATTGTAAAAAAAGTGTATGAAAATAAATTAAGAGCATTAG
GAAAGCTATCTAACTCAACGCAGAGTCAATAGACAACAGTTCTTCATATAGAACCAGTAA
TTTGACACATTTTTTGTTTTGACACATACGGAAAGATTTGAGCAGTGAGTTACCTTCAAT
CAGAAAATGTCCAAAAGTAGGGACTGAAGCCATGCACTTTTGCTTATGTTTAAAAAAATC
TAAACAAGATAAAAAAGTTAAAGATAAATTCTTTAGATTTATGTGAAGATTCTGAGTGAT
AACAAATAATTTCTTTTAGGATTTAACAGAACTTTGTGCGTAGCTGAAGTGCGCCATGAC
GTAGCGCGGCTGCGCTGACGTCACCGTCTCTCTTCTCCGGTTATGCGCGCGCGAAAGTAG
CGAAGTGAAATCTCACGAGCTCGCACTGATCAAAACCAACAGATACTCTCTCTAATCGAA
AAACATCTGCAAAAACCATGGCGGACACAAAGGTAAGAGGGCCATCATCTTCAGCCTCTG
TGTCTTTCGAACAGCGAGAGATGCTTATTTTGGTTGTTTTGTTGGCGATAAATGTTTTAT
GAGGGTCTTACTTAACAGACTGTAAAAAGCAGGTGTTTTCCCGGTTTTGCATTGTGCGCT
TGGATATTCAGACGTTAGAACTTCTTGGTGTCATTTTAAATACTCACTATTGCTTTTTCA
TACGCTGTCAAAGTCGTTTGTTTATTTACAATCACGCTTTACATTCAGTAGCACCAGTAA
CGTTATTAAAATTCATTATTCTGTGTCGATTAGCACTCGCTACTTGCTTAAACACAAAGG
ACAAGCAAATATTGATTTTTAGGAACGTAATAAACATATTCCTCGCATGCTCCAAGTAAA
AACGGCTCATACTTTAATTCGAAAGCTTGAAATGCTAACGCACTGTTAGCTTGTGTGTTA
GCACTGCTAACCTGCGGCACGTGAAGTTCAAACCCGGTTTATCAACACTCTTCCGGGGTT
AATTACGTGATTTAACTGTATTTGCTCAAGCAGTGCAAAATATGGGCTGCGAAACTACGA
GTCGAGCACTTAAACGCCTTTAGGCCGCTTATTAGCAGCTTCTAGCTTGGATGCTAACTT
AACTGACTGACCACTTTTGAAAACTCGTTTAACTCCCACATTAATTCATACACATCTGAT
ATCCGGTCTTCAGTCAAGTCAGTCGTTTAGCTAAGTAAGCTGCTCAGCTCTGAAAATGCG
AAGTGATCAACTTGGGAGCGGTTCAGAGCATCACATCATGTGCAGAAGATCTGCCAGAGT
TGATCAGAAAGCTTTTCAATAATTAAAGCTTACAAGGCCTTCATGAATGTGAGACCAGTG
ATTAGTGAAGAGCAAGTGCATTGATTCCGCCAGCATCACAGCATGCGAGTTCAAGCACCA
GTGGATGCAAGTTTGGTTGCAGCAGCAAATTTGGAGACAATAGGCCAAACTCCAGAGAAT
GATCCCTCCAAATCCCGCAGCCTTTCACTCCACTGATCTGATGAGTAATGTGGAAGCAGG
ATCCCCACAGAAGGGATCAGGACTTGTGAGCCTCAGCAGAACAAATACTGTAGTAAATGT
GTGGCGTTCTCCAAAAATACCTGTTTTAGCTTATGTCATGTTTAAGTTTGATTTAATAAA
AGCTGCTCTTTTAATTTTCCCCTCCAGGAGGCACAAGATGAGCATGAACCATCCACTGAG
AACGTTGAGGAATCCAACCATGACCCTCATTTTGAGCCCATCGTCTCACTACCCGAGCAG
GACGTTAAGACCTTAGAAGAGGATGAGGAGGAGCTTTTCAAGATGTAAGTCATTAACTGA
GGTTTATATTAGGGCTGCACAGTAGATGATTTCAGCATTGATATCGCAATGTGAGTCCAC
AACAGTCTCATCACAGGGATCTGCAATGTAGTTGATCAGACAATACGGTTAACAACATAG
TGGCGTTGTTTAAAAATTTTAACCTTCGAATGAAAATGTATTATTTGCATTTGTTTTTAA
GACTTGACTGTAGGAATTTGAAGCAAATATAAGCCATTTTGGCACAATACATTAAACGTT
TGTAGCTTAAAGACTGATTGGACATTATGTAGTTATTTACTCAATTAAAATGATAGTGTT
GTTGTTATACAGTGATCATTTAATTTCGGCTTCTGAATACTGTTTGACTCCCCAGAAAAT
TATAAATCCTCGTTTGTTTGCATCTTTTCTCTGTTGTATTTAACTTTGCTTGTAATTTTT
TTAAATTATATTTTATGCAGATATGCTCCCTTACAGAATCATCCCAGTCGATCTAAAATT
GAGTTCTTTACAAGCTATTTGTCATCTGCTGAAATTTATTTAAATTATATAAATTTATAT
TCATTTATATCGCAGTGAATAAAAATATTTCAATGTCTATTTTTTTTATAGTATCGTGGA
GCCCTAGTTTTTTAATATATTAAAAAATAAATAAATAAAAAATCCCATGTAACTGCATTC
TAAGAGCACTTTATATCACACTAGCTGTTTCCATCCACTTATTTTTATGCGCATTATGGA
TATGCTCATAAAAAACTGGTTGATGGAAACGCCAAAATGTGTATAAAAACTTATGCGCAT
AACTGTAGGATAAACTTTTTATTCGATATAAAAAGATGCGCATAAACTGATGGAAACGCT
TTTAACGAATATATTTCAGTATATGCATTAAAGTCATATGATTTTGTTATAAGAGATCAT
GTGATGATAAAAATATGTGAATGAATAAACCAGCTGGCTGAGCACCCTGTGAACATCTGA
CATGTTGTTTAGGTGATTCTAAAACGGCTTAACTATTTCAATATTATTGTTATTATATTA
TTAATAACCTCCAGAATCAAGAGCATCTGTGCTCCGCATCTTATGCCTTCTAATGTCACT
ACTCGTTCACTGCGTGTCAGGATTGCCTTCTGAGGCGCAAGTCATTTATTAAATGAAGAA
AAGATTCACGCAGCTTCTTCTACCACAGCCAATTCAGTTTCTACTGTTGCCACCATATAA
TTAGTAAGTGACGATTTTGTTTGCTTTGACTTGTTGGATGGAAACTGTTTTATTCACACA
TCTTTTATGCAATATTCCAGTTTTGTGCATTATTAATTAGCATTCTTTATAAAAACATAG
CTACTTATGCATGCACTAAAAAGTTTTTTTATTTGCTTTTTTTAAAAACTGTTTGATGAC
AGCTTAAAGTGTTGTCAATCACATATATTTATAGATTACTAAAAGGCTTTTATGCTTGTC
ATTCTGCGAAATTTTTTAATGACCACAGAGTCAGGACCTCAGTTTAATGTTGCATCCAAT
AGATGGCGAACTGACAGTATAGTGTCCTCTTCATTTTCACTGGGGGCATTAGGACTCACA
ATGACCACAGGTTGAGCGCCCCCTGCTGGCCTCAAGCACCACTTCCAACAGCAACCTAGT
TTTCTCATGTGGTCTCCCATCCAGGTTCTGACCAGGCTCAGTCCTGCTTAGCTTCAGTGA
GTAACCGGTCTTGGGCTGCAGGGTGATATGTCTGTGTAAACTAAAACTAAACATGCATTG
AGCAAGAAGATTTTACCAATACATATTTTTGTTGGTTTACACTGGAACCATAATTGTACT
GTTTTAAAAGCAGCTTTAAAATGCTGGTCTTCTGTAAAGCAAATGTTTTTTTTTTTTTTT
GATTTACAGATACTATTGTATACATCAGTCTTGTCATTGATTAACATTAATATGTGATGG
ACTAACACATCTGATTTTCTAATTACGGTAAAGTGTAAGGATAAATTGTTCAAGTATACT
TGCTATTATACTATTCTATTATTATTTTTTACATAATTTGTGTGTTTGGCGTGACTTGAG
AGAACTTATTCTGCATCTTTTTTTTTTCTGTGTGTTGTCTTGTGCTTCAATGGTTTAAAC
TTATATTGTCTTGAAATTACAGTTGACACTTTTGTAAAAGTGTATTTAGTGCTTGCCAAG
AGCCATCAGGCACTTATTGTTATATATACAAACTATACATTGAAACTAGGTCATTTATAG
AAAATATTAGTTATTATATCGTGAATATTAGTTACTCACACAATCTACATTGTAAAAGTG
CTATAGAATTAAAGAATTAAATACGTCTTTGACCATTGATGCATTTTTGTGTGTAGGAGG
GCAAAGTTGTATCGTTTTGCCAGTGAGAACGACCCTCCTGAGTGGAAGGAGCGCGGGACA
GGTGATGTCAAACTTCTGCGACACAAAGAAAAGGGCTCCATCCGCCTTCTCATGAGGAGA
GATCGTACCCTCAAAATCTGTGCCAACCACCACAGTAAGTGGAGCGAGTGATCTCTTGAA
TTCTTTATTTTTTTTCAGTGTGCATATGGCTTTAATTGATCTGTTAACCCTTTGCTCTAG
TTATGCCGCTGATGGAGCTGAAGCCCAATGCAGGCAGTGACAGGGCCTGGGTGTGGAATA
CACATGCCGACTTTGCAGATGAAAAACCCAAAGCAGAGATGCTGGCTATTCGATTCCTTA
ATGCAGAAAGTGAGTATAATTGAACAAATCTCAGAAATCTTGGTAAATCTTTTGTAGATT
GGTTGTAATTCAGTTTTTTGCATGGCAGAGAAGAATGGAAGTTTATGCACAAAGCCCTGC
AAGATGATATGATGGAGCTGCACATTTGAGTCGTAAAGAACAGAATTAGCTGTGTAATAT
AGGCACAAACTTTTGATATTTTAGAAAAATATATAAAAAAGTGATACTGTGCATGCAAGT
GAATTAAATTGTTATGTGACGAGTGTCTATAAAGGTTAAACATGAATAATACATATGATG
GCTGAAAGAATGAGTGGCACACTATTTGCTACACTCATTCAAGCACGGGTGACTGTTGTG
CTATCTAAACTTCAGAGCTCATCTGAGAATCAGGCCGTGCTCACACTAGGTACACTTCCC
TTGAACTCAGCCGAAGCATGCTTGTCCCCCTTTCCCTCTCCCCTGACAGCCTGCACTCAT
TGCTTTTACCTTTTGTGCCAGAGAACGTCATTGATGATGTGACTGTTCAGTTTAACAGAA
AGAGAAGCGCTCTTGCTCAGCACAGTGGAGATTGCTTTAGTTATATCGTCTTGCATTATT
TTTAGTTGTTTGTGATGCTCTGACACGCGGTCAAATATTTTGTGAATGGATCCACCTCTT
GTGATGCTCATAAATGTTCATGAAAGTCATCGTGCTGCACGTATTAGGAGGTTTGCTGAA
GGTGCAGCTGCCGATCAACAGGGGTTTGTATCTTTAATAAACTGACAGTTCATGTTTATT
GAAAAGTAAGTATATGTAATGAATCGCCAAAGCTCAACCAAACTGCACTCTGGCACATGT
CTTTCAACCTGGCCAATGCCAGCCAACCGAACTGTCTAATCCCGATTCGTAGAACTTACA
CTTGTCAAACAAACCGGGATACGTGCCCGAGCATGGTTTGGATAGCCTATTGTGTTCACC
CTCACCTTATGTGTTTAACTGTTTGAGTGCGCATGAATATGATGCAATATGACGACAACG
TGGAAGAAAATGTGTTGTAAATTATAACAATTTCCTAATTGGTTTACTATGATAATTAAA
AAAATAGCTCAGCTCAAACGTGAAACTTTCTTTTTTTTTTCCACAAAGAAAATGAAAGTA
AAACTCTTAACCACTGAAACTAGCACAGCCAAACACAGAAAAGTTGCAGTGAAAGTAGCA
ATACATCTTCCATTTTAGTGCATGAAACAAAAAAACAGGGTTGGGACTTTCCATCCATCT
TTGAAAACTGTGTGATGGGGTGGGGTTTATTTGGACCAGATGATTCTAGAAGTCTGGCTT
GCATTACCAAAGTGAAATGTTTGACTGTGGTGCTCAGTTTATTACAGATATAAGGTTAAA
AAAAACTAAGCTTCATGGAGGCAACCAAAAATGCTCTATAATTAATTATTTTATTAAATA
ATATAAAGTGGTTTTGTAAAATGTAGCTTTTTACATTGCACTCAATTTGACTTGACTGTT
GTTTACTTTTTATTAACTAAATCATTAGCATTAATAACTTTTTCTTTCCTCCTGTTATCT
TTGTCTTGCAGATGCACAGAAGTTCAAGATGAAGTTTGATGAATGCAAAGAGGAGGTCAG
GAAGTTTCTTGAAGGTAAACCACACTTTCAGCCATGTCACCATGCAGACTCACTCTGTGT
AAGGCAGATACCTCCAGCCTTAGACTTTTTCTGTCTGCTACATTAACTTGAAGATTGTTA
CAACCTGCCTTGCCTGTCACTTGGCAGGGTGACTGTACCTTCTCAGACATTTATTTCTGA
AATTATTGTGAGATTTGCATTGCAATACTCTTTAAAGAACCATGAGCTGAACTGTTTTAA
TTTAATTTCACAGGAAGCATGAACAGCGCTAACAAAGTGGCAGAGAAGCTGGAGGAGTTG
TCTGTGAACGATGACAAAACAAAGAGTTCAGAGGACAAGAAAGAAGAGGCGAAGAAAGAG
GAGAAGGCTGTTGAGGAGAAGAAATGAGCCCAGGAACGTCGCTTCATATGGATCCTCCAC
TTGCCATTTTCCCCTTTTCTACAACAGACTCTGAAAATGAAAAATTGGACACTTTTTTTT
TTTTTTTTTTCCTTTTTGGCCTCTTGACTTCACAAGACCTTGGTGCCACTCTTAAATGCG
TCCATTTCTCAAACTTCAAGATGTTGTGAGCTTTTGTCCCATTCACGAACTCCCATATCG
CCCTTCATTTTCTCATACATTGTGGACCAGTCGTCAGTCATCATGTATTTGTGTATTTAC
ACGACATGCAATGATACAAGGCTTGTGCTATTGATTGATTCCCACATTGGGTAACCTCTT
TTGTTGTTTTTTCTTTCTTTTGTACTTTACTTTAAAGAGTTATATTGCGAGTGTCTAGAT
GAGCACTGTCTGATATGAAAGCGGGCTGTATGAGAGTTGATAGGGAGTATGAGTATCTGA
GATCTTTGACTTTTCCTTACAATAAAGTCACACGAGGAATATTTGACTTCTCTGTGGCTT
GAATTCACGCTTGAGTAGCATAATTTTTTTGGCGGATTGAAAGAAAATAAAATGTTAGGG
ATGCTCCGATCGATCAGTTGGAGATCGGTATCGGCCGATAATCACATTTTATAACTTAAT
CAGTACTTACCGATCACAGGTGTTTGTTCTCGGGTTTCCTCGCAGAGATAGATGCACATG
CACTCAACAGCGCTACAACACCTGAGGAGGTAAATGATGTGTGAGGGATGAGAGTGATCA
TGGCGATCCCAACACAGCAGCTAAAATACATACAGATGTGGTGCGGCCTTTGTTTATAGT
TTGTTGGCGTGCCTTAGGCGAGTGATGGTGTCTGAGTCTCTTGCAGCCAATGCATATCCA
GTGTTTTGAGCTGCTGTGATGCAAGTAAAGCAGTCTCCCCTATGGTGTCATCCAACCATG
TAAGCTCCACTATATACAACAGCTTCATGACACCCACAATTAGGTAAAATGCCCCAAAAT
CATGGAGCTGAGATGACAATTAAAAAAGGAATCTATTATTTTCTGCAAAGCTCATTCTGA
CCAAGACATGTCCACACTAAATGCTTATAAGACGCATGTTTAAGGGATTATATACAGCAT
CTTTCATTTATTCTCCAAGGTAAGAGATTTGCACTGAAGTATCATATTGGTCACCATGTA
CTTTGTGTTGGCTGCAAAAGTCCTGATTGGAGCATCCCTAATGAAATGTGCTCCATCGTG
ATTAACTGATGGAAGTCTATGACAAAGATAGACTTGATATGTACAACAAAGATATGTAAA
ACAAAGATATAAAGAATGGTTGACAATTCTCTCTGGTGTGGAAATGCCGGAGGGTTTAAA
GTGGGATGCTTTTTAAGAACAGAAAGATAAGTGAATATATTAGGTACTGTATCACTAATT
AAATGCAATTTTCATTCCATAAAGTTTGTCGGAACTTAAATATGAAGACTGCATGTATGA
TCATTTGGGCTTTTAGTCACTGTTTTTCTTTTATTTTGAATGTAAAAAAATTTAGAGGAT
GCTGTTTTGAAATTGTGTGATGATGATGAACAGCAAATTTTCCACATTCCCAGTTTTGAG
TGGTTTTGATAAAAAAACAGGGTCGTTTAAATTGCATTTGGCGTATGATGAGTGAATTAA
TCTCACATTTTATAGTGCTAACTAATACATCATGTAAAAGGGTTGAGATCAAACCAAATT
AAAGACTGGTGCTTTTATACATTAGTGTCTGTTTGGCTTCCATTTAAAAGCCTAATGGAG
CAATGTTGTTTTGATGGAAATAACTAGCGTCAGTGAATCATTTAGAGACTTAAGCCATAA
AATAGCTTTGCTGATTACAAGAGGAAGCTTAAATATGTCGTGTATATGCACAGATTTAAA
TGCAGAGCTATAATGCAGCATATTACATGATATTAGAGTAAATTAGAATTTCGTGAAGAC
TTTATAATAAGTGCTGAAAATGATTAGCGTGTTCTTCATTAATTACAATAAAATGATAAT
ATTAAATAATATAAGTTATATTAACAATTATATGTATTTTAAAACATGGGTATTTTTGTT
AACTACGCAACTCCATGCGGAACCTTTATTGGTGAGGAAACTGTTGCGAGTCGGATGTGT
CTGAAGGACGGAACCTAAACAGCCACGTAGTATAAGCAGGAACACGTCTAAGGTTGGTGC
TTAATTACTTTTTATCGTATCTTCTAATCACTGCAGTAATTATTTACTATTACACGTGGT
TATTGCAATACATAAGCGTGGTCGTGTGTCAGTGTCACGCGTAAGTTTAAGGTTTTGAGG
TGTCGTGCGTTGTGGCTAAGTAGCTAAAAGGCTGATGCTAACGAGATCAGAGATTTATTA
TGATAAACTCACTTTGACAACGTACTGTATATCCAAGATATTTTTGTCTTTATGCCTGAC
TGCAGTTTATAATGATTGGTTTGTGCATAGCTGTGCTTTAGTTTTCATAAATTTAAAATA
ACAGACATTATTTCTTTTGGGAAAGTGACAGGTAACGTGAATCAAAACTGCTTTTGACAG
ACCGCCTGATCTGCCTGTGTGTGACTTTTAAAATGACTCGTGTTTATGTTGATTCTATAG
TAAAGTACGCTTCGTTAACGTGTCTGATTAGTGTCTTAAATCACACTAGTCTATAGTTAA
ACTGCAGTGGGCATGGTTAGACTAATCGTCCAGCTTTGTGTAAAAGAAATCCTATTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 2367..2503, 4856..5013, 5100..5228, 6791..6853, 7093..8956
1157..1171, 2367..2503, 4856..5013, 5100..5228, 6791..6853, 7093..7226
NC_007116.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved