Danio_rerio Locus carm1
snOPY snoRNA Orthological Gene Database
Danio_rerio carm1
Danio_rerio
carm1
3
SNORA74
10848..11045
25191
AAAGTAACATTTAAAGGCTTAACTAGGTTAGGATAAGTAGGCAGATTAAGGTAATTAGG
CAAGTTATGTATAACAATGGTTTGTTCTGTAGACTATTGAGAAAAAATAAAGCTTATATA
TAGTTTACAATTTTGAACTTAAAATGGCTTTTAAAAAATTAAAAACTGCTTTTATTCTAG
CCAAAATAAAACAAATAAGAATTTATCTAGAAGTAAAAACATTATCAGACATACTGTGAA
CATTTTCTTGCTCTGTTTTTTATACTTTTAAGGTTGTTTTTTTTACCTTAAAAAGTACCA
AAGAACACAACAAACAAACAATATTGTCTCAGAATATACACACTTTGCAGGTAAATATAT
GAATTGCCATACATGTGGGTTCAGCTGTTGGGGATAAAAAATGTAATGTCACATTGTATG
TAGACATCAAAAAGTCCTATAAGGTAGTGTGCCAGTCAGTTTTCATAAAGGGTGCTGGAT
TTGGATAGAGCACGTTTCAGGTCTAAGTATCCAAGAAAGAGTTCCCAGGTAACAAAGAAT
TTTTCTTTGGAATTAGTCTTGATAAATCTGAGCCTTTCTAAGTGGACAATGGAGGCCATA
TCCATTAACCAGGTTCGAAAAGGAGGAGGAAAAGAAGATTTCCAGTTTTTTTAGTATGGC
CACATTTTCTTGCTCTGTTAACAATAATTTGGGAAATATTTAAGAAATAAAAAAGAGGCT
ATTTTGTCACAATATTTGTGACAAAAAATATTTAAAAATCTAAAGGTCAATAAAAAAAGA
AGTGCTTGTTGCAAATCAAACATTAATTTTGATATATTTACAGTGGAAAAGTTATAAGAT
GTATTCAGGATACTACTTATAATTCTAATAATGTTTGGCATAAAATGAAAATGCATAATT
TAGCCATACAATCTGGCTATTTCTGGCCATTGACAAAAGTATACCTATGCGACAATTTTT
TTATTTATTAATTTTTTATTTTATTCTTTTGCACAAGGGTCACATGTTCTTTTAAAAACA
AAACAAAACATGATATTCTAGAAAAATAAAAATAACTTTGAACCCAGAATTTATCTATTG
CAATGTTGAAAAAGGAAATCTTTTTAAACTAACAAACTTGAATTTGATATAAACAATTTG
ATTTGGAATATTTACACACTTAATGATAAATGTAACTTACTCCGAATGTTTGTGGGAGAA
AGGCGAGAAGTGGCCATGTGGAGGCAGTAGTAAGTCAGGCCTGTCTTGACCACTGACTCC
AGCGCAGATCTGAGCCGCTGCACGCTGCTGTCTCTGACTCTCTCCAGATCGAAGATGGCG
GTGTCCGTGTTCTCAGGCGTGCGCCTCCTCTCCATCGGAGACGCCAATGGAGACATCCAG
CGGCATTCAGAGCAGCAGCCTCTGCGACTGGAGATCAAGATGAACCAGGACGCGGCTCAA
ATCATCCTCTCGAACAGTGAGTAGATGCGGCTTTGTGGACACTTTGCATCCGGCCTCAGC
TGAGCGGTGTATCCTAGCCTAGCCGAAGGAGAGTGATGCGCGTGCGGCGTGTGTGCGTGC
GTTGCGCCGCCTGGACACCGGGAACGGAGGCGTGCGAAGTATTGGATCAAAAGCGGCTCT
CGGACCCGTACATGTTCTTTAAAAGATTTAAAGCTGCCTAATATTGAGGTTTGGTTGCAA
CATGGTTGCCACAAACCACGTTGATAGTAGCATGTTAGCATCTGTAAACACTTCGTATTG
TGTTAAGCTGCTTATAGTTAGCTGCTGCTACCCAGCTAATATGTACAAGCCGCGGCAATT
CAGCAGTGAATGTGTTTCCCTAATGTGAAATAAACACATGTCCCGTGCATGAGGATCCTT
GCAGGCGCGTGTCCTGGGCATCCAGGCTTTCTTCGTCCGGACTTTTCGAGAAAGTGGATT
GGCGCCTATAAAGTTAGCCGCGGACTGGAGCTTCAGTCATACTGTTAAGCTTCAGAAAGT
GATGTGGACACATCTCTTGTTGTGTTTTCAGGGGCTTCCTTTGTGTAAACATGTAACGGG
TTTGTCGAAAGTGTTTTCGGCTGGTTGTTTGGTGGAATGAATGGGCATGCTGAGTTTACT
TGATTGACTGCGCACAGTTCTGCACCACCTCTCCACTTTCACTAGTTACACACCAAAAGC
ATTTGGTTATCCCTGAGAGTGCAGGGAATGTTGCTAAAGTTTATAATGTTATAGTCACAG
AGCGGTTTCTTATGGCAGCACCGTTTGGGCATTCATCTTTGTTCTGCGGGGAACAATAGC
TGGTCCCCCGCCTCCTTTCCTCCAGCGTCCCGCCTGTTCATTCAGCGCTCAGGGCTTTTG
TTTGGAGCCTCATGCTGCCGATGTCCCGTGGATGAGATGAATGTCTTACTGAAACAGATG
CGCGACCCACATCGTATAGATTTCTCATTGAGAAGTTTTCGAGCGCCAAATGCCGCAGCT
CTCTCAGCATTTTCAGGCGAAATAATATTTATTTATTAATTAATATATATTTAAGAATAT
CATATTTATGAGTTGCATTTTTGCGCATCTTTATTCACCTTCAGTCTTTATGAGGAAAAA
ATCTGTTAAACTAAAGTATTTGTGTCTCTCACTGTGGACTGAACACTTTCTGTGAATATG
AATAAAATGTACACTGGTGTGAGATGAATAATTATGACGTAAGGGTCTGTTTGTTGTTTC
GTGTAGCGGGTCTCCCCCTTCTGCGTCCTGCAGTGTTGACGTCACGTGGCAGACCTTGTT
GTGTGGTTGACAAGGTTGCTGATTATAATAAAATGATAAAATTGAATTAAAATTATAATA
AGATTAAAATTTTTATTTAATGTTATTTGAGTATTTACAAAAGTATATATTTATTAGCAT
CGGTAAAACATTTAGTTGTGTACACAAAGCGAATAAAAATGAGATTGTATTATAGTATTA
TATTTGTAATTTTCATCATTACTCCAATGCTAAAACAACAAATTATAATTTGCACGTTTA
AAAATATTTATACAAGTTATCTACTTACCAAATAGTTTAGTCAAAAATACAATACATTTA
TATTTTTTATTCAACTTGAAATGGCTGTTTTCTATGTTAATATATTTTAAAATGTAATTT
GTGATTCATTAAAGACACTATCCTTTGGAAATTGTCATCATAAACCAAAATGCATTTTAC
ATATTATTTGATCAAACATTATTTGAATTGTCATGTCATGATTTCCACAAAACTTGAAGC
ACAAATGTTTTCAACATTGATAATTGTTAGAAATGTTTCTTGAGCACCAGATCATCATTT
TCGAAGACTCATGTGAAACAGTAGATCGGAGAAGACATTTCATTGAAAGAAATAAAATAC
AGTAAATTGTATTGACAGTTATTTTTTATGTGAAAAACCTTTTCTCCAGAGTTTATTGTA
TTTTTGATCAAATCAGTGCAGCCTTGGTGAACAAAAGACACTTAAAAACATTTTTAACAA
GTCTTAATGGTTCAAAGCTTTACACTCATGTATACTCTATAAATTAACAAAGTATTAAAG
TGTACACAAACATTCTTTGCTAGTTAACAGTATTTTTACACATTACTTTCAGTCCACACT
AGGCATGGGCCGGTATAAGTTTCTGATGGTATGATGACCTTGAGTAAAAATACCACAGTT
TCACTATATAACAGTATATATTTCACAGTAATTACTGCTCTAAAATATGTTCTTTTTGAA
TGTCTTGGTTAAAAAAAAAGTTACATTTAAAATATTTTGAAACGGTAAGTCAGGCTAAAT
CATTTTAAAAAGTCATTGACTTCTGCTGTCTTCATTAGAATTCATTCACAGATTTCTTTT
TAACTTGAAAAGGCATCTTTGCATATCTTTCCTTTTTTGGATATTAAGTAAAGCAACTGC
AATGTTCAGCTTAAAGGTTTGCTTTTCAGATGTTTCCTGAATCCTGGTCCTTTTCTACTG
TTGCCTACTGTTTTTCTACTGTCATTAAAAAAAAGGAACTTTAGGTACTTTAGGAACGGT
ATAACAGAAAATGTTAGCTGTTTTAAAACCTTGACTTTTCCAAATAAAATTCATTATCGT
CCCATGTTTACTCCAAACCCCTTTAGACCAAGTTTAGTGGCTAATTGCAAATGTATATTT
AATGGGGGAAAAAAGTACAACATTGAGCACTAACAGAGCAAAGACTGACAAGTTGACAAG
CAGCACTCCTGATGTAAAGCTCAGATTATCATAGGTTGGCTTCAGTCACCTAGCCTCTGT
TAAAGTGGGGTTTTCTTGAGCTGCTGTAGAGACTGTATTTGTTTTCAACTCAATTATATA
ATTGACTACCAGCCTAATCTGTCTGTGGAAAGCTTGAGATAATCCTACAACAGCTGGGGA
AATAAATGACAAAATCCCTCATCCTGGCATCACCTTTTACTGTTGCAGTGTCGAGAGCTC
GCCAACTTAATGTCTTTGAACAAGGCTGGTTGGTTTGATTTTGTTTAAGCTTGTAATGGT
AACATTAAATCAGCAAACAACTCCCAGGAAAGATGAGTATTATAAATGCAAATATATTTA
AAGTATACACATGTATGTGTGTGCTTTTTATGTATACATAATACATATCCACAGTACATG
TATTAAGTAAATAAAAGCTTTTATTTTGTAATGTAATATGGTTTTATATAGTGCATTTAT
TACCATACACCCAAAGCCTTTTACACTCATGTAAGGTAATTTTCGCATGCAATTAGTCAC
ATTTAATCTTTAAACAACACTAAAATGAACTTTTTCCTCACAAATTTTTAAACAATTATT
CACTTAAAAGTGAAGAAATTATCATTTATACTCCCTTTTATTCCAGTTTATTAAAGTTTT
TTATTTTCCTGTGGAGCACAAATGTTAAAATCAATCTTGTTATCGCTGTAAATGCCAGTC
CAGTGTTGTTTTGCACCATTGACATTGATCATTGACTGTGACTGTATGGATAATGTTTTG
AAACGTACATTTTCAGAACAATTAGTTGTTGTTTCTTCACTTAAAATGGTCAATAATATC
CAAACTTATGAGTTGTTTTAATGCAGACTGCCTATTAGATTTATAATAACACTGTTATTG
AATTCTAAAGGAAATGTTTTGCTCCCCTCCACAGATGAGGAGACGTGTGTCTTTAAGTGT
ACAGTATTGCGGGAGACAGAGTGCAGTCGTGTCGGGAAGCAGTCCTTCATCATAACTCTA
GGCTGTAACAGTGTCCTCTTGCAGTTTGCATCTCCAGCAGGTAAAACACAGCTTCTTTTA
CAAGCCCATAATCCTTCATTGTGATTTATCAGACCTTCAGACAAGTGCATCGCCAGTCAG
CTGGTGTGCAAACTCAATTAAATAAAAGAATCAAGCTCGTCCTAATGTGTTCACTGCTGT
TGTTTTTCACTAGATTTCTCGTCGTTCTATAACCTCTTGAAAATTTGTCGTGGACAAAAA
GGCGACCGTTCAGTCTTTAGTGACAGGACAGAGGAGTCTTCAGCTGTACAGTATTTTCAG
GTGTGTCTGGCTTCTTATTGCCCTGCACGTGCAGATATTCATTTGATTTTGCCTTACAAG
CTGAACCATGAAGAACAAGTTTAGAGAAAATCTGACTAGCATGACCGGAATTGGCATGTT
GTGAACATCTTTTTCCCTCCATTTTCTTTCTCTCAGTTTTATGGGTATCTCTCTCAGCAA
CAAAACATGATGCAGGATTATGTACGAACTGGAACATATCAACGAGCCATCCTCCAGAAT
CATACTGACTTCAAGGATAAAGTAAAGCTATTCTCTTTATTTTCTCTTCTCCTTTTCTGT
GTTAAATGTGCTTACAAGTTGAGAAGTTTTCAAACTGTTTTTTCAGTGCTTATTTGAGCA
TTTTTTGTTCCTAAATGTCATTAGTCAGGCATTTTTGCTTTTATGACTTTAAGGTTTAGC
TTTGATGTTGTTCAGACTTAAATACCTAAAGCTGGAACAGTTGACTTATTGCGACAAAGT
AAAAGGGGACACCTGAGTCAAATTTATTTTGAAAGGTTGCTCTTTTTTTTGAATGATGTT
TTTCTGAATGATTTCTTATTAGATTAAATCTGTGGTTTGGACTTGGTCTTGCCTTGTCTT
GTGATTCTTATGCATCCTTTTATCTTTTTTTTTTTTGTCTCAGGTGGTGCTGGATGTAGG
TTGTGGCTCTGGCATTCTCTCATTTTTTGCAGCTCAAGCTGGTGCCCGTAAAGTTTATGC
TGTGGAGGCCAGCACCATGGCTCAACATGCAGAGGTTAGACACATTCCTCAATCACTGAC
ATGCGCTTCTGTTCAAAAAAGGTAGATTAGTCTCTTATTTTTACCAAGGCAGCATTTTTG
TATATATTAAAATTGAGTTTATGCTTCTAATGGCAAAACTGAGTTTTCAGCATCATCACT
CCAGTTCTCAGTTTCACATGATCATCCACAAATCATTGTAATAGACCTATGCAAAGATGA
CGTTAAAAACCAAAACTCTAATTTGCCACTTGTTCACTGAAGGTTTTACAGTTTAGGAGT
TGGTACTTGGAGGTTTTATTGTACAATGTGAACGTTACACACACACACACACACACACAC
ACACACACACACACACACACACACACATTCTTACTACATTTGAAAATAAAAATAAACATT
TATATGAGTAAAATATGTTTGTTGCACAGCAAAGCGTAAAAGTTTGGATAATTTATCTTT
ACCACAGACTCACAAATAAAATAACTCAAAGAAAAATACTTAAGGTTGTTAAGATAATTT
AATAGGGTCATTTTAGCCATAAACTCTTTGTAAACGGCCCGTTGTTCTACTCTTACAGTA
ACTAACAGTATTTACAATATATTTTTATTTTTAAATAGAAAAAAAAATCAAAAGTCCTTT
TCCTCTTGTGTTTTTGTAGGGAGGTTATTTCGCCATTAAAGTTGTTTTTATTTATTTCTG
CTCTAACATGTATAATAAGTTCTTTGCTGCAGAGATAATTTTACAGATTAGCTTTTATAG
AAAATAACTCTTTTAAATAAGTTTATCATACGATGCTGCTCATGCACCTAACATTTTGGA
AAAACTGTGCTAAAACATGAAAACTGGGCTGATGTACTGTTCTATTGAGATTTTTTTAAC
GCTGTCCTGGGATATTACCATGCTTTGAAATAATCAACTTTTTATTTGCGCTTTAACACT
TTTTAACACATCTATGCACAAGTACACTACCTAATGTAAAGGAGCAAATTGAACCTGATT
GGTTAATGGGGTAGATGACACAGCCAGATACCAAAACTAACAGTTTAATGTTTATTTTTA
GGCCGTGCTGAAAACTATCATTCATATTTTACACTTAAGGAGTCACTTTTGAGTTCTTAG
TCTTGCATTGTTTTGTTGCATAGGTTTGAGGTCTCATATGAACAAAATAGGGCTGTGCGA
TTAATCGAAATCGAATAGCAATCGTTATTTGAAACATTTCGATTAGCGAATGGCAAAAGG
CTGCTATATGAAATATATATTAACTTTCCCACCCAGACCAAATGTGTAACTGCCATCTGT
GTGTGACAGTCTTACTAGCCAATTAAGTGAGCACACTTGCATTCTGCCCAATCAGAATTG
CACAATCAAACTATGCGGAATGCCCAAAATAAAATACAAACAAACAGGAAAGCGCAAACG
AGTGAGATGACGGTGTCTGCAGCTTTAGAAGCATTAATAGACAAATTAATATCAAAGAAA
AAAACGCATGACGATAATATGGGAATATCTTGGTTTCAAAGTCACTGACACCAAACAAAA
CCAGGTAATTTGTAAGAGTTGTCGCAGAATTGTTGCCACAGAACGAGGAAATACAACCAG
CACCTAAAAAAAGTACCACGGGCATCTATATGAGAAGCGTCTTGCTAAAAAGTCAACTAA
AATTACGGTCAATGATACACAATCTAGTATCAAGCTAAGTACAATTTTAGAGTTGTTTGC
TAATATAAGTTGCTATCTTTTCAGTTCCTTTTTTTTTTTTTAACTAAGGGCATACAAACT
CTATGTACAGTTGCCTTGAACCGAGCCGAAGCACACTCATCTCCCCCTCCCGTTTCCCCC
GACGGCCCGCACTCGCATCACATTCGGGCCTGAGCATGCGTACGTCATGGATAATGCTCT
GTTCAGTTAAAGAAGCGCTCTCGCTCAGCACAGTGGAGATTTCTTTATATCGTTATATCA
TTTTAGTTGTTTAATATGCAGTGACACGCAGTCAAATATTTTGCTGAACAGATCAGCCAC
TTTTGACACTCATAAATGATCATAAAATCCTAGTGCTGCAGGAATTAGGAGGTTTGCAGA
AGGTGCAGTGAGGGGCTTGCGTCTTTAATAATCTATGACAGTTTGCGTTCATTGAACAGT
AAGAATGATTAATAAATCCATATGAAACAGTCCCTTAAACTCGCGTCTGGTCTTCAGTTT
CGGGTTCAGTCATGTTTTGCACTCACACTACAGGCGTACCGGGCCTGAGCCCAAGTGAAC
CGCGCTCTGTCACACCTCTTCCAGCAGGGCCAGGGCTGGCCAAGTGAACCAAGCCTGAAC
CCGATTCAGAGCACTTACACTTCCCAAACGATCAGAGAAACGGGCCTGGTCATGGTTCAG
ATAGCATAGTTTGTGTACGGCCTAACACTCACTGCATTTTAGCAGCAAGAAGCTATGATA
CAGATTATTAAGCTGAAGCTTGACTACAAAATAAATAACAAATCAAATTCAAATCGCAAT
ATCTGTAAAAAAAAAATGGCAATTAGATAATTGCACAGCCCTAGTACGAATCCAGAAAAT
AGATTATCAATTTCATGATTTTAATACTGCATCATTTCAAACGTGTTTTTAGTATATAAA
TTATTTGAATGCATGGAAAATTGATTTGGATACAATAGTGGTGGTTATGCCAATATGGTG
GTACTAATGATAATTGTGTATCCACAGGTTCTTGTAAACAGTAACAGGCTGTCAGAGCGT
GTTGTGGTGATTCCTGGGAAAGTGGAGGAAGTGTCTTTACCTGAGCAGGTGGACATTATC
ATATCCGAACCCATGGGCTACATGCTGTTCAATGAAAGGATGCTGGAGAGTTACCTACAC
GCCAAGAAATTCCTCAAGCCCAGTGGTGAGTGAAAAAAGTCTTATTCAAAAACACTGACA
TATACAAACATCTGTACATATTACACCTCTGCTCTCTTCACAGGCAAAATGTTTCCCACC
ATTGGAGACGTTCACCTCGCTCCGTTCACAGATGAGCAGCTTTACATGGAGCAGTTTACA
AAGGCCAATTTTTGGTGAGCTTTCTTAAAGAGGACATGGACACTGGGTGGGGAGAGAGAG
AGGGAGAGAGTAAAGAACAGCATGTACGACAAGAAGTGTGTGCAAATAAGTGTGTCATCA
TACCGGTAGCAGATTTCAAATGATAGACAAAAAGTGTAGATAAACAGTGATTTAAGACTG
TTGAGGATGACAACTCAGGATGATTTACTTAATGTTTCCTCTTGAAAAACAGAATTTTCT
TGTTTTTCAGGTACCAGCCGTCTTTTCACGGAGTGGATTTGTCTGCGCTGAGAGGAGCTG
CAGTAGATGAATACTTCAGACAGCCTATTGTGGTGAGAAATGGGAGGGAATGACTAGCAG
ATTGGGTGTGTGCTAGTTAAAGGACATGCTGGCTTTTTAGACTTGGCTACAGTTTGGAAA
GTTGGTAAGGCAGGAGGCCATAAAACACACGAGCTTGTGTTTGTGCCTTCAGGGGAAAGA
TTACCCTGATAAATAGTGTGTGAAGTATGAAGGTAACTGGAGATTTGCCTCCACACCAGT
TATAGATAAGCAGTGAGCATTGGGGGGGGGGGGGTAAATACGGACAGGATTGAGTTTCAT
ACTTAAGCTCAAATGAGAAGGGAGGATGTTTCTAGGAAGAGGAGAAAGCCAGTTTGCTTC
ATGGATTAGCAAAATAGATTCAGTGGTGGTTGTATATAGGAGACTGAAGTGAAGTATGTG
AGCTCGCCTTTATGTGCGTGATGAAAGGCTTTACTTTGTGGTCAGGGTTTCCGAACTTAC
TGTTTTTGTATGGTCGGTGGGAATGCAATGAATTTTCGCCCATCTAGAAGAGTATATAAA
AGCATATCTTTGTATGTACAGAAAGTCCACGTGTAATTTTGCTTCAGGGGTCGTTGGTGT
AAGAGTTGCTGTTTCCTCTTGAGAAGCCAATTATTGCAAGTTGTCGACTGTGCTTTTTGT
GTGAATTTTATTTTGCAGATTTTCTTAAATAGTTTACAGGTGGGCTGGGTGATGAAACTG
TAATGATAATTAACTAAATGTTCCATGATTAAACAATTGCATGTTCAATATGTTTGGTCT
AATTTAATATGCTTTAAAGCAGAATTACTTGTGTGAGTGTTTAGCTTTGTTTTACATGCG
GATATGTCTCGTATTGATCGTGCAAACATTAAAGGGCAGCACTTTGAATTTGAAAATGTT
TATATTATTTAGTTTAAAGGAATATGAAATGGCACTGATGAACAGGAGAAACACTATGCC
ATAAACGATTGATTTACCATGGATTTAACATGCTAGTATTTACGGCGCTATGCCATTGTG
GCAGGGTTGAGAGATATGATTTGTTATATTGTTAATGTAGGGAACTATTACACTGTTTTC
TGTTTATTATTGTATTTACATTGGAGTTTTTCATGTAATTATTACATAAACCAGAGTTTC
TGTTTGTATCCTGTTTGCCATGATAGTTTTTTTTTTTTTTGTCATATTCCCCAGTTTTTA
TTTCAATATGTCCCAGTTGTAGTTTCCAGTCTGTTTGTGTGCTGTATGCCCAGCATTAGT
CAGCTGTTCAGGCATTTTCAGTGCCTGTAACGGTGTTATACTGCTGGGACAGTGACCTGC
CGCGGTCTGGCTCTAGATGGCGCTGTTGTAGCGTCTTTCAGAGTTCAGCTGGAGGCAGGA
GAGCCCTCTGAGCTAGGACTGAGTCTGCTTCGCTGTGGCTCAGCCCTTGACAGGAGGCCT
CACAGAACGTCGTTGTGTTTGATTTGACCCACTTCCTGATCCAGATTCAGGGCTGAAGGT
TATTCTGCCTGCTCTCATTTATCCTCTGATTTCTTTCAGGACACTTTTGATATCAGGATC
CTGATGGCTAAATCTGTCAAATACACAGTCAACTTTTTAGAAGCTAAAGAAGAGGATCTT
TACAAGTACGTTTACACCCAAAATCCGATTTACCTTGCAGCCTTTTTAAGATGTGTAGTA
TAAGATACACTCTCCACTTTTTGTTGTTTTCTTGTCCTTTCCAGGATAGAAATCCCCTTC
AAATTCCACATGATGCATTCAGGGCTTGTACATGGGCTGGCATTCTGGTTTGATGTTGCA
TTCATAGGATCAGTGTAAGTTACAAACCTGCTATTATGACCCGTTACCACTGAGTGGTAC
GGTATGGGTCGGTACACTTTTATGGTGTTTTCACTGTCAAAAGGTACCAAAAAAAGCAAA
CTGTACCATACTACTTTTTGGGTACCCTTTCCAAAGCGTACCTAGCATGACAAAAGGATA
CCAAAAGGTGGAGTAAGAATGGGGCTTCCTTTGTTTTCATTCTCCTGGCTTGTGCACAAG
CTAGTGACACATCTCTGTAAACCAACAGCATTATTTTTAAATACACAGCCAAGATATTAT
ATTGTAATACTAAATGCAAATAATAATGAGCCATGGTCGACCCGAGCTCAAACAAACCTT
GTCTTCGTCTTGATGAACAGTCAAAAAGGCTACAAAAACAAAATCTGCTGTGTCCTATTG
TTGTTTTACGAGGGCATTTAAAAGCGTGTGTGGTTTTATTTTTTCCAGAGAGCTTGTGTG
CGCTCGCTGTGCGTCTATACTTAAAAATAACGAACTTCTCATGATAATAACGTGCGCGTA
ATTACTGAAGTGCTTCAGACGTTCAATCCTTTCAGAAACTGACAAACTTGAGAGTGAAGC
GCAAAAAAACAAAAAAAAACAAAGGAAAAGCCAGAAAAAACAAAGGAGCTGATCTTCCTT
CAGCAACCTAAAACTGAACTAACTGCCATGCTTAACTATTATCATCTGCTTTTGGACTAT
TATTATCACCTTATGGACTTTGAACTTGGAATGACGTAATTCCTTTTTAACAAGAGGTTA
CATGTGCTGGTGAAGATTAAAGATACAGATGAGAGGTTTGTACTGACTGTAGACTATATG
TTGCATGTTGTTTTTAAACCCAAATAAGGACTAAACGTATGCTGGTACATTGGTACCTTT
TTGGCAGTGGAAACACAACCCTGATAAAGGTGACCTGTACCGAACCACTCAGTGGAAATG
GGCCATTAGTGATGTTTTCACATTTGAGTCCATTCTGAAAGAAACAAACTTTACCTAAAA
AAAAAGTGTGTAATGTAAATAATACAATAAAAATAACAGGTATTATAATAATGAAATTGT
GTGTTTATTTCCCCAATATATCTAGAGTAGTCATAATGTGAAACAATTTAAATTTTTATA
TTTTTATGAATTTATATACTGTACAATTTAAGTATTGTGTGCACTGTTTATAGTTCTAAA
AGTAGTGTCGTATTATTACTACAACATTAATTATGATAATAAATATTTGGAATGAAATAT
GAAAACAAAGTGAACCCAATGTGCTAATCATGAAGTAATTTACAACATTTCTCAAAAAAT
TGCTATTGTACAGATTCAAATGTGCATTCTTATAGGAAAAGCAGTAGTCACATTGGTGTT
ACTTTTAAATTAAATTATTATTATTTAGAATTGTTTTACTTGGTTAGATTTTTAGAACTG
AAACACAAGCATGTGCATGATTAAAAAAAGATTACTAATCATTTCCAATGTCATACTTCT
GTTGTACTCCTTTATGTAACTTAACTTTAAAACTTTAACAACTTTGTTGTTGTAACAGTT
TTTAAAGATAACTGTAAAGAATTGCTGTGTTGAAATTTAAACATTGTGTAAACTTATTAA
TAATTCCACTATTTGGATGTGAGGGAGCAGATGTACTGTTTTATAATCTGTGACAGGTTT
GCTCTTGTTTATGTGTTTAGGATGACGGTGTGGCTCTCGACGGCCCCCACAGAGCCCCTC
ACTCACTGGTACCAAGTGCGCTGTCTGCTGCAGTCACCTCTCTTTGCCAAGGCAGGGGAC
ACAATGTCAGGCACTGCACTTTTAATCGCCAACAAGAGGTAAGGACACACAATGTACAGA
ATTAACATGCTTTCAAATTCATTTGCATTAAATTTGGTCTCTCTTGATCCGTATCTTGAA
TGACACCATTGTCATAATAATTAGTCTGTCATTTGGGAACCACACATAACATTTTTGCTT
TACTTTTCTGGAATTGTGCACTTGTTTTAAAAAATGTCTACCATAAAATGTTGATGTATA
AAATGTAAAATGTTGTTTAATCCTTGATTTCTAGTCATGTTATGGTTTAGGATGCTAATA
ATGAAAGTATAATGTGCACACATTCAAAAAACCTGAGGCAGGTGTTTCATCAAAAGAATT
GCTGAACTTTCATTAAAATAACTGGCACTCTGCCAGTGCTGCGTTTAGTAAAAAAAAAAA
GAAGAAATTTATTTTAAAATGCATTATTTTTACCTAAAGGTCTTTGTGTGTTTGCCTGTT
GGAGACCTTTTGCTAAAAACTTTGTATTTTTATTAAATTGCATTTTGAGATCAGAAGTGA
CTGTGTGCTGATTTTTGTTCATATACAGTTAAGTATTTAGGATCCAAAAAAGCTTTTGTA
GATACTAAAAGGGTCTTTAAAACCTTTGATTTGTAAAACCTTTCAGATGCTCTGGTTAAA
CCTCTTTTTTGTGTTTTTTGTGGTTAACAGACTCATTTGTTTCCATTTCCTCTCTCAGAC
AAAGCTACGATATTAGTATTGTTGCTCAAGTGGATCAGACAGGCTCCAAATCCAGTAATC
TACTTGATCTCAAGAACCCTTTCTTCCGGTGAGTGAATGCATTTCTTTGGAAACCAACTA
AACAATGCAGAACACATGCTGCGTACCAGTGTTGTTTTAGTTTCTTTGACATAACATTAT
AAGGGCTTTTCACATAACAATAGAGCTAGATAATGATAAACTGAATCATAGGTTGTATTG
CTTCTGGTTTGCATATTTCATAAATTAGATGGGGTTAACAAATAATCTTGGATATAGTTT
AAGAATGCTGATGTTTCATAATGTATATTCCTAAAATAACATCTTTATTATGCACATTTG
TAGTATAAGTGTCATTAGCCAGGTTGCCATGCAAGAGATCTTTTGCTACAAGTTTTAATG
GATAAACATTTCTTACAATAAAGCTTAAGTGCCAATTAGCAATTATTTTAAGCAAATGTC
ACTATATATATTTAACTTTGGTTCATGAATTCTGTATTGATACTTTAAACGTTACAAAAA
CTATTCTGGACATTCTTTCACACACATGGTGTCACATAACACATTTTCAGGAGCATATTG
AATGGTAGGCTCACCTGTGCAGATGCCAAGCTGCAAACACCAGTGCATCATGTGCACTTC
CAATGCAAACCTCTTCTATTCTGCACCTGTCATCAACAAGGGCCTGGAGAACAACAGATG
TCCACCCTTTGCAATTTAATGTAATCACTGTAGCCTTCAGTTGGGGAAGAATAGGCAGGT
GTGTCCCATTCAGCAACACTGTAAACCGGTGCTGCAAGATGTCTCAAAGAATTTCAGTAG
ACCCACAGTGAGTTTTGCAGTAAAAGTGCTGTTCCTTTAAACTAAATTAGATTCAATCTA
TCTTTTCAATTATTTGTGAAATTTTAATCATATTGAGATCAGTAAACTGTCCGATAGTCT
CAGACATCACATCAAGCACCACCCACAGACCTTTTTTTCTAAATGTCTGATGCATGTGGC
ACACATTTCTGGAAACACTTTAGCAGATCCTCATTTGTCCTCTGATTGGTTTAATTATAC
AGACTTTCTGGCAGTCAAATGTGCAACAAGCTTAATTAGCCTGTATGAAAACAAAGCTGT
GATGTTTATATTGAGGACAGTGTTCATTTAACGTATAACTTTCTGAGAAATTGATGAATC
AGAGATATACTGACTTCACATCTAATACTGTAAGGAAAACTTGGAGCATTTATCAATTGA
ACTTAAATGCTGGATTATTAAATGCAATACTCGCTGCAAAAAAAGCTTCAACCCGTGATG
TCGACAAACCACAGGTATGCATATATATATATATTTTTTTTCTAAATGGCAGTGAAATCC
TTCAGATTTTCTATCATTTTGGTGATAAAGAGAAACGCATCATTCAAAACAGTTGCTTTT
TTCACTTGTGGATGCTCACAAATCTAACAAAACCTTGCTTTTAACGAACAAAGAAAACTT
TCACTCAGTCTGTCTTCTCTTATGAAGAAATACTTCATGAATAATGAACGAATCTCAGAA
CAAAGCCTTACAGATATCCTATATGTTTTGCTGACAGATAATTAAGGATATTGATGCGTC
GTTGTAAACGTTTAAAGACAATAGTGAAAGAGTGATTTGCAGTTGCTTGACAGACTATTT
ATCTTCAGGACATTTCCACACCCACAAACATTGCATGACACAAAATGTGATTGGTTAGTT
CACTTGTCAGTCAAATAACATAGGCATTCCTTGACCATTAAAGTGGCTAAAGTTCTCAGA
GCTACAGTCGTCAATCTGAGGTCTGGCTATGCGAGACTAACTGTCAGAACACTAAATGGT
GGTTGTTGTTTTTTGAGGAGGAGGGGTAGACGTAGGGTGTTTGGGAATAATTTCTAACAT
GAAATAATGGACGGAAACTGCTGTTATACATTTGCAGTAACTCCATATTTACCTTTCGTC
AATCGTGATGTCATCATGCACACCTGTTTATTATGAAAAGATTGGAACGGCAAAGGTTGT
AGATGGCGAGTGTCAAATGTTATTTCTTATACATTTATTTTGTCAACAACAAAACAAAAT
TATATGAAACCTGGCTATTGATTTGAGCACAGCATGCAGCCTGTTTACATGTAATCTGTC
AATTTAAAGAATTGTTTGTACAAAGCACTATTTCCATGACTGTCCAAAAAATGAAGCACA
TGATTGGCTGTGATGTTCTAACATCACGTAATATCACACTATACTTGCTTGGCTCCTTAG
TGTGGTGTTATTATGCAAAAGTAATGGGTTTTTCCATTCCTTTACCTGGAGTTAGAAGCA
GAACCCAGAACAGTGGAAAAGATCCTGCAGTTTTAATTAATATTTTGAAATAGATTTTAT
TTTTCTAGTTTCTGTTTTCTATGTAGCCTTTATTGAAGTTGTGGTAATTTTCAGTCCTTT
TTATTTTTGTTAAAATGTCTGTATAGTTTCAATTCTATTTTTAGTTTTAGTTTACTTTCA
TTTTAACCTAACCAAAAACAAGGAATGTTGTCTTGTACATTTTGGGGAGGAATATGAAAT
ATTCATATTTCATTAACTTAAAAAATAATTTGTTTTTCCATGGCTCCAAGTTAGTTGACC
ATAATTCCCTTATTCTGTGTTGTGTTTCACAGGTACACGGGCACAACACCTGCCCCTCCT
CCAGGTTCACATTATAGCTCTCCCTCAGAGAACATGTGGAACACTGGGGGAACATACAGC
ATGAGCCAAGGCATGGCTGTGTCAGGTACAGCACCTGGACGCTTCTTACAAATTCTAAAT
GTATTCCCTAAATTCTCCTCATGGGAAAACCTGGTATAGTCATGGAATTTTGACATGGCA
TCTTTCAGGCCTGTAAAACATTTTGGAAAGACAAACCCGCAATGTTTTGGAAAAGTCATG
GAAATTTGTTTAACAAATATGTGTATACTCGAAAACATTTTAATTGGTATTATTAGTTAC
ATTTTTATGTATAATTGTGCGGTCGGTCTCTCAATGTGACTTTGTCTTCGTGAGCTTAAA
AGAAAATTAATTATACTTAAGTCAAGGAATATGTTGAGTGCTGTGCTCAGAAACAATCGC
AAACTGCAGAGGCAAGATACTGTTGAATTTGTATTCTTATAAGTCTATAATTTTTTAAAA
TATGATCACACAAACGGCAAGATATCAGCTATACAGTAGTTTGTATGTGGTGAATGCATG
CTCTCATATTTATGTACTTGAGGACTGTCCTTATTTATAGAAACCGCCTTCTGCAAATTT
ATCGGAACAGAGTGTTTTATCATAAATGTTTAATATGTAACCTATTGAAGTAACTGGATT
TTGGTTTCACTTTAACATAAGCTCAATTTTGCAATAGAAGATATTTGTCAGTGATATTTG
TCAGGGTTTTTGCTATATACACTAACTTATGTTTTATAGGTCATGTTAAAACAAAGGGTT
AACAAAATAATGTCAAATTATTAAATATTATTCTTGCATGTGGGTTGATGTGCAGCACTA
GCAAGTGGCCCCATCTAGTGGAGCCCACAGTATTCTTCAGTTTTTACCCTAGATTGGTAT
TTTGGATTGGTACCTTACATTTCTTTTCTGAAAGTTATTATTGCTTAATTAGTGAAGTGA
TGCTGTTTGTTAATCATATTAATATCAACATGAACCAGTTAATCTATTTATTTAAAAATG
TTATGTTAAACTATAAAATAGCTGGAGTCAGAATTGAGTTATCGTAATACCTTGTGTTTT
GGTTTGCCAAGTGTGAAACTTTTATTTTCTGAAAATAGGTGCATATAGTATTTAGCCTCC
TTCCAATCTTTACTTATAGTTAACACTGATTTAAGCTTTTATTATTAATGTTATGAAGGA
TTTGTCTTTTTTGTTATTAGTTTTATCATTTGTTATCAGTAATGTTTATCATTATTTGTA
AATTGTGTGTAGAAATTACAATTAATGGTATAGCCTTGGCCAATCACATGCTCTCACATA
ATGCTTCCACACATCAATGTTAAATAAAATAATATATCATACATTTTACATAGACATAAA
ATAAATATAAATTGCATGTATTGTCACATATTTTATGAAATGCTGTGTTGAAAGTGCACA
TGCATTTTTACTTATTATTTACCTTGTATACAGAGACTTCGCATGACACATTAGATCATG
AATATTTACCTGAAAGTAAAGGTAAAATGAACCCTGACTGTTGTGATGCGACTCAGATGT
TTCTCTCTCTCTCTCTCTTTGTGTTTCAGGGATGCCTACAGCCTATGACCTCAGTACTGT
CATTGGTGGCAGTGGGACAACCGTGTCCCACAACAATCTCATCCCCCTTGGTACAGACAC
GCATGCACGTATGGATATTTACACACACGCTCACAAATACACATAATACTTTCTAGCCCT
CTAAGATCCCAACTGAAGTTTTAAAGAAATTACATGAAGTATTAAAGGGGCCACATCGTG
AAGGATCCCGTTTCAATTCAGGGTTTCCACAGGTCATGACATTTCTGGAATATTATGGAG
TTTTATCAGGGTATTCAAGTCATTAAAAGTCAGAGAATTTTACATATTTTTCATGTCAAG
TCATGGAATATCAGGGACTTTTATTTGTCATTTAACTTCCCATTTCTGTACCATGTTTGA
TGTGTTGTTTCACATGGTTTTGCCTGTTGTTATGGTTAGGCTATTTTTCACTGCCATTTT
ATTTTTTTTACTTTGCTATCACCAATCAAATGCATTCATCATGCTGTACTTGTGGCTGTT
TTTAACTGCGCAGTGCTCAACCAGTCCTTCCTGAGTTTTGTAGGGGAAATTTTTTTATTA
TTGTAGCATAAATGTATGGAAATTGTTTGTTTGTTTTTGCTGTGGCTGAATGTTCATTGC
AATAATACAACTTGATGTGAAACACGTCACAGACCTAAGTGCAGAAGTGCAGTGCCATGC
CATACCATACTGTACCGTCCCGTAGGGCTAGTCCAATAAATGCTATTTTAATCAGTCATG
ATCAAATTTATGTCAAAAACATTGATAGACTCTGCACTTTTTCACTCTTTATTGATCTTA
GAGCCAATCACAGAGCAGAAATGTACAGCTATGGGAATCTAAAAGTGAGTTAAAATTAGA
ATGTACCGAATTTTTGGCCACTGAAAATTTATCAGTCAAAAATGTTCTATCACTTAGTTA
GGGTGTCTGCGGGGTCTTAAAGTATTAAGTTGATAAATCAGTTATGAGAAAATTAAGGCC
CTTAAAAAGGATTAAAAAGTCTTAGTCACATTTTACGAGGTCTTAAATTTTGTTCAAGCG
TTGTCCAAAGTGTTTGACTCCAAAAAAGCATAAATATATTTATTTTTCTCCTAATATTAA
CAACGGCGTACTCGATCAATGCCATTGGTTCGTGCTGCGGTGTGTTCTAGCTCCTCCATG
GGTGATGTAATCTGCGACAAACGTGGGAAGGTGATGTGACACTCTTCGCATGTAGCAAAA
CCATAGAGTGAAACAGTTGGTAAAATGTAAGTTTGCGTACTCTAATTGAGGAAAGATGAG
TGTAAACAGTGGCTGAAGCCTGTCGCTGAAAACAACCACGTAATTTGTATTTCATGCTTT
GTTCCTTCCGAGCTTATCCGTGTTCTGTTGCATGGTTGTGCTCCATTTAATTTTTTTATC
TACAACTGTTAATTAAGTTAAAGGTTTGGTTCCACATTACTAGAACTTTCATTAGTTGAA
CTTGAACTGGCGATGAAGTATTAAAATATTTAGAGAAGGTCTTTAAAAAGTCTTAATTCA
AATGAGGGTTCCTGCATATACCCTGGTAATGGACTCTCTGATTTTTGTGGCTTCAGTCAT
TGTTGGGGTACTCTTAAATCTGAAAGCATTATCAACTTGCGTTAATATATATCATTATCA
TTCAATATGGATAATAATAAGGTTAGGTTTTTGGCATATCGCCCAGCCCTAGTGTACCGT
GTCTATGACGGCTCAAGAGATCACACACTAGTTGAGCACTTTCTATATGTGAATATGCTA
TTTAATATAAAACTGATCCATGTCCTGGTTGCCCAAATGTGGATGGACCGCTCGACACAA
CAGCTTCCTGTTTTTTCTGTTCATAAAAGGTCATGAAAATTCAGCTTTTTACTCAGTGAA
AGTCAGGGAATTTGACATTTGGCTTTCAGTGGGAACCCTGTTAATATTTCTGTTACTTGC
ATACATCAAAACATTTAAAATCCATTTTAAAGCTAAGCTATAAAGCTACTTGAATGGCCC
ATTATGAGTTTTGTTGGTGGAAGGCATTTGATATAGTCTATGTGCAGTATTCATTGACTA
CTGTTGGATGATCAGAAAATGCCATTTATAATTGGACCTTGTGGAAATAAAAATAAATAA
ATGTGACCCCTTTAATATCCATTCTAAAAGCCTTAGTTTAAGACTCTGTTTCAGTCTCCA
AGTATTAAGGTGTTGATGTAGATGACATTGTCTGTGTAAATTGAAGAGGGGTTTGTTTGT
GTTCGTTCCTCTCCAGTGAACACGGGGATCGTGAACCACACTCACTCCAGAATGGGCTCT
ATAATGAGCACAGGAATCGTCCAGGGTGAGTGTCTATTTCTAGAAATGTACATCACTCTT
TAAATGTATGATTTTCTCACCATCATGTCATATTAAACAAATAGGGAGACTTTGATCAAC
TACTTCATACAAATAAGCTTTCTTACAAGCAAAACAAGAAATGTTAATAAAGTCAATTGT
TTATTTTGAATATGAATGATTGCATTTATGTAGAGTTTTTAACATGATTTGCTGCACATC
AGCTTTTAAAGTGCTCTTATGTGCTTTATTGTAGAGCTGCACAATGTATCAATTCAGGAT
CGATATCACAATCTGATCATTTGCAATAGTCACATCGCGAGAATATGCAATGTTGAGTCT
GAATTATAATTTATTATTTCACAAGTTTTTTTTTTTTTTTGAGGACTTTTTGAGAGTTTT
AAAAGCATTCAGGCTTTAAATATTGTACTGTTTGTGCCCTTAACAAATTAACCATGATAA
GTTTTATTGAGTTTTTAAATAAAAGACTATGCAGTATTATTGTACATTTGATTATTCAAT
TACTGTATACCTGAATACTGTTCGACTGTTTTTTACATCATAGGTCTCAAAGTCAATTCG
GGGAGGGCTGCAGCTCTGCACAGTTTTGCTCCAACCCTAATCCAACACAGCTGATGCCAC
TAAATAAGGTGTTCTAAACCTTTTTGAGCAACTCGATTGTTCAAGTGGTGCTCGCTGCAG
AGCCATTTGGGCGAGCTGAGCTCCAGCGAGGGGGAGCTTGAGCTTGAGCTCCACCTTTTT
TGCACTTCTTCTACGAGTGATGTCACTGGGGGTAGGGTTAGGGGTGGGGTTGGTGTACGC
ATTAAAACAGCTTACAGGAGGAGGAGCGAGAGCTCATGCTCCCCCTCGCTGGAGCTCAGC
TCTGCTCAAATGGCTCTGCAGCGAGCACCCTCTCCGATTGTTTGGATCAGCTGTGTTTGA
TTAGGGTTGGAGCAAAACTGTGCAGAGCCAGGAATTGAGTTTGTGACCTATGCTTTACAT
GCTGTCACATGATGAACGAACGACTCAAAAACCAGAAAACTTGAAAGGTGAACTAATCAT
GGCTCCTTTCAGCGCAGACTGTGTGCATTGGTTAAGCTTATATGGAACTGTCTGTGTGAC
GTAAACGAATGACTCAAATTTAAGCTGTCAGAAAAGGTGAGCTGACATGATCATAGACAA
AAGAGCAGATAAACAAGAAATGATTATTTTCTCTATTAGGCGCATATTAAATGTTGATGG
AGAAGTCCATGCGAGTGGCTACTAACAGTAGTATCTGTTGTTTTTTTGACGACTGCACAC
ACAAAGCAGGAAAGTCACACCTTCTGGATGAGTTGTAGATTAAGAATCTTATAAAAAAGT
AACTCTTTATACTGATGTTCAGTTTGTTTAAATTAGTTTGGTGTTACAAATGAATCATTT
CAATCAGTGCCAGGTTATACTATAATTCATTTGTATGTAATATATTAATATAAGTACTAT
TCAACTTGAAGTGCTATTGACTTTATTCTGTAATGCGGAAGTGCGCTCATTTTGCAATTT
GTTTTAGGACTTCCGATTCAGTCGTCTATGAGAGAAATGACTTGGAATAATAAAATGATC
AAACTACTTTCTCTACAAACAAGTGTTTACATTACTTTCTTACAGCATTCTAGTTATGAC
TTGTTTGTAGTGTGATGAATGTTTGGGCTAGTTATAGATGAGTTTTAAAGCAACTCGTAG
CCTTTTAATATTTTAGGCAAATTGAACGAAATGACTCAAGAAAAAAAAAACAAGATTTGT
TCATCTCAACAAACGAGACTCAAAGGTCCAAGTCAGTAAAATGATTCAAACTTCACATCT
CTATAAATCACAAAGTTTTAAGATGGCACAATGTGAGCACTTTAAGGCCTTGATCATTAA
ATGTTCTGAGATACAAAGGTTATAATGTTGCATTTTTCTTCTCAGGGGCAACAACTGCGC
AGCAGGGTCCAAGCAGCGCCAGTCTTCATTACCCCGTCACCAACCAGTTCACCATGGGCG
GCCCGGCGATCTCCATGGCATCTCCAATGGCCATCCCCAGCAACACCATGCACTACGGGA
GCTAAGGCTGAGGGGACGGCCTCTGCATGTCCGATTCTCCAAACGTCCCCTTTACCCCCC
CTGCAAACCAACAGCCAAATTCAGAAAACCAAAACCAGTGCACCAGTCTCTGACCATCAC
TTTATACTCTCTCTCTGTCTCTACATATATATATATATAGATATACATGTATACTTATAT
GTATATATTCTAAAATTTCTTTCACTGGCGTTTTATTCTTACATATCCGTCCCGCGGCCC
TATAATGTTAGCGTGCGCAGGCATTTGGCCAGTTCAACGTGCCTGAGTTGTCACTGTTAC
TCACAAATCCCCCTCCTCCAAAGCCACATGCAGCGCCTGCTCCACAACCAGCCACTAGGA
GGCAGCACTTGTCTGTAAGCATGCTGAAAAAGCACAAACCAGAGACTCAAGACTCAACTC
AAAGGACTCGGTCAGAACGCTAACGATGGGACACTTTTGTTTTTTCTTTTCTTTTTAAAT
AAATGCTTTACAAATGTGCACGCCCCCTCCCACCCTTCATGAACTCCCACTTTTTTAGCT
TCACAAACTCCATCATTGACTCTTAATATGAATTTGAGTTTCGAGGATCTTCATCGTACC
TTCACTTCACCGTTGGCTTTTTAACGTTTCCAGCAACATGGACAGGCCGTCGCATATCAA
CTTCTCTCAGCATGGGCTTTCGGCGGCCATCTTGAGTTGACCTAAATGTTCGTCCAGGCC
TCTCGAGAAAGAGACGGACACGTGCTGTAGATGCTCGCAGACTTCATTACGACTACTAGC
GCAGTACCGCTGGATCCTGCCTGTAGACAACCATAGCGTAGATAGAGATCGTCTTTCTTT
CCATTCCATTTCTGACTGTGTGTTTTAATGTAGTGCAGTTGACGTGTGTCGCTTGGTGTT
CCCCGAGGTGAATTCTGAGCATGGTTTAATCGAGACTCCAACACCACGCAAATCTGACTT
CATCATTTGGCAGATTCGCTGACAATTATATGGACACAAATGGTTTAGGAATACAAAGAC
CAGCACCAAACCCTTCACTACCAGCCAGGGAAGGAGGGTAGATGCTGGGATGGACAGTCA
GCACTGGGGGGGGAGGAAGATTGATGCATGAATGATAAAATAAAAATAAAAAAACAGTTA
GGTCTGTGGACACACGCACACACTGACCACAGCAGCAGGACAACTGTTTGGGAATTGCAG
TATCCTAGTTTACGCCCCCGCCCCCCCCAGTAAACCCTTATCTGAACTTCTGTGTGTTGT
GAGACTCGTTGAGGAAAGGAGGAGATGAAGTGACGCCTGAGCAGCTCCAGCTTTCCTCCT
TTCACTCCTTCACTGGGGATTTGACCATTACCCCATCCAAGACTCTGAAGTCGTATGCAC
CGCTTCCACTCAATTTTTTTGGTTTTGTTTTGGGGTTCATTTGGTTTGATTTAGCAAGGA
TCATGAGATGGAAAAACAACCTTGTCTGGTAGTTTGTAGAGTTAACTTTTTGTTTCGTTT
TTTTGTTTTCTTTCACAAAAAAAGCAACAGACAAAAAAAGGAGCATATTAAATGTTGATG
GAGAAGTCCATGCGAGTGGCTACTTATAGTAGCATTTGTTCTGTTTTTTGACGACTGCAC
ACACAAAGCAGGAAAGTCTCACCTTCTGGATGATTTATAGATGATTAAGAATATTACAAA
CACAGTAACGTGTAATATTGATGTTCAGTTTGTTTCTATTAGTTTGGCGTTACGAATGAA
TCATTTTATAAGCCATTTATTAAGGTAATGCCTGGTTATACTATTCTTCATGTGTATGTA
ATGTATTTATATTAGCACTGTACAACTTGAAGTGCTATTTACCTTATCCTTCAATGTGGA
AATGCGATTGTTTTTGCTATTGTTTTAGAATTTCCGTTTCAGTTGCCTATGACAGAAATG
ACTAGGAATCGCTCGTACGGGAAGAATAAGGTGAATATTGCATTTAGAAATCAACATTTA
CTAAGGTAAGCTGCAAAAATATTACTTCTTAGTTTTGGATGCTCCAATCAATCTGCTGAA
GATTGGTATCGGCCGATAATCACATTTAATGACTTGAACGGTGTTCGCCAATCTGGCTGA
TCTCATGAACCGATCGCAGGTGGTTTGTTGATGAGTTCACATGCAGAGGAGTTTTTATAT
CTGTGTTATATTATTTTCTGTAAAGCTGCTTCTGGCCATGGTATGTCCACACAATGGTTA
TGAGAGATGCCTTTAAGGGATTATGTGCAGCATTCTTAATTTATTCTCTTGGATAAGGCG
AGATCTCCACTTAAGTGTCATACATGGAAGAAAAATGCATTATGAAGCTTGAAGCATCAG
AAACAGTACTCCATATCGGCCAATCACAATAACAAAGGATCGGTATTCTGAATCGGCTGC
AAAAATCCTGATCAGTGCATCCCTATTATTAGTTCATGTCAGCCATTTTGATAACCCATG
GAACATTGCGTGCACCCACATGACATCTTTTAAGGAACATAAGAGGAAACGTAATGACTT
TTACATAGTTTAGGCAGTGCAGTTTCATTTATGACTTAAGACTGTTTCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1455, 5134..5259, 5413..5519, 5676..5780, 6163..6273, 8967..9144, 9223..9313, 9550..9631, 11139..11224, 11324..11413, 13100..13237, 13918..14007, 18209..18307, 20476..20544, 22485..24191
NC_007114.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved