Danio_rerio Locus LOC101886800
snOPY snoRNA Orthological Gene Database
Danio_rerio LOC101886800
Danio_rerio
LOC101886800
2
SNORA13, SNORA13
1687..1816, 2125..2260
3687
TAAATGTAATGATAATCATTCATGAGCTTGTCATGAGAGAGGGTGGGACCATCTCAAAT
TTTTGAGAGTTCATTGGATGGTGACGCTTCTCCTTTCAGCTATTGGCTCGAAGGAGTGTC
AATCAAAGTTGCAGAAAAAGGCTGGCGGCCATTTTGTTTGCCAGAGAACTAGTGTTATGA
TTGGAGACGCTACTCTATTGAATGCACCACAGCGACTAGTTTGGAGGATTAACATGGATG
TTTATCAATGTATGCATAAGTTGTGGACTGATGTTTTAAGGATTGGATTGTCTAGAACCT
TGATTGAGAGGTGAGTCATTCTATTCACGCTAGAATCATCCTTTAAAGATGGATGTTTAA
TCTTAGTTGTAGTTTGTGAGGCTTCCCCTTAAAAAGTGTCATGTATGTTACCGCTGGTGC
ACCCCTAGAAGAGAGTTCAGCTTGGATCGCAGGCATCGAGAGTTTAGGCAAAGTTCATGG
ATGGTGATCGAGTTTTTACTGTGATCTTGTTGGAGAATTGGGTTGAAGACACAGAGATTG
CATTGTGTGAGGCAATTGAAGTAGAAGGTTGAGAAGTTGTAGCTGGAGAAGTTGTTGTTG
TTGGAGAAGTTGATGTAGCTGGAGAAGTTGATGTTGGAGAAGTTGTTGTATTTGGAGAAG
TTGTTGTAGCTGGAGAAGTTGTTGTTGTTGTTGTTGGAGAAGTTGATGTAGCTGGAGAAG
TTGATGTAGCTGGAGAAGTTGATGTAGCTGGAGAAGTTGATGTAGCAGTAGCAGTAGCAG
TAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAGTAGCAG
TAGCAGTAAGTTAGCAGTAGATGCAGAGCAGTGTATTCTTCAAATCAAAGATGACTGTAG
TGAGAAAACCCTGGCTCTTTATAGTGGTTAGGAATGGCCTGATTGGTGGATCAAGCATGC
TAATGCAGGACCAGCCGTGTTCAATCATAATCACGTGCTCCTCTCGAAATTAGTTTATGA
ATAAACTTCACTTTGTGGTTGTGTCCACGTGGAGAGACGATCAAGTGCAAACCAGTCTCG
CCGTGCCCTTCTTGACGTTCCCTTGTATAATACGTAGGTTAGTAATACATATTAATTTGC
CGTGAGTATGTTTAATGATAAAATTTATTTTTTGGTATGAATTTCTAATAATGTTAGCGG
AATTTCTGTTTGTGGACTAGTCTGTTGACTCACACAGTTCTTCTAATAATGTAATGCTGA
TTTAGCTAATAATTCAGCTAAGGTTAAATCTGTAAATTGACACACTTGAAAATGCTTTAT
CTGTGAAACTCCAGCAACTGTGACCATCCAATTAAAAATGTATAATATGTTTTTTATTTG
AATTTGTTTGTGCCCGCTCAATTGTTTATTAATGCAAATGTTTGTGTTTTTTTTTTTTTA
GGATTATAACGAAAACTAGCAGGAAATTGCACGCGCAATCATGTCACATGCTGACAAACC
ATGAGGCCCAGGAGAAAATGCATATAAGTCATGTTAGATTGATCCATGTGGGTATTTTCA
AAGATTACAACTTTTGATGATACGTTGGACAAGCAAAATGTGTATCGTATGGCAGATTCA
GTATAAACTGTATGAACGTTCGGTTTATGCTAAGCTTGCCATGCGGTTTTAAGTGCTGAG
ACACTCCTGCCTTTGTGTTGCCCATTCATTTCCTATTAGATGAATGTGGTGTCAACTAAG
GCACACATTAAACCTTGAAATAGCCAAAGAGAGGACCGGCCACTCGTTCTCTTGCTTGTG
CTGTAACAAGAACAACATTTAGAATTAGTTACAATAACTTTGTTCTAAATGTGTGCAACC
TTTGACGATTATATTGTATCATTTCAGGTGAAATCCAGTAAAAGGCTACGTTAACATGGA
CAGGATACATGAAACTTGGTATGCAGCTATTAAAATAACTTAATCTTTTTGTGGAAAGTA
ATTCAGAAAATGTGTGTTTGGCCATTCTTTTTACATGGCTAATGTTGTGGGGGGATTAAA
TAGGAACTTGTTAAAAACGCAGAAGAGTTTGAACGTTTTTAAATGTCAAGAAAACTAATA
TTTCATATAAATGTTCATTTTATCATGCCTTTTAGTGTTGCCTGTTCATCATTGCTTGTC
AGATGAATGTGGTGTCAAATAGGGCATACATTAATACATGACATGGCCACTGAAAGGTAT
CTCCATCCTTGCCTTTCAGAGGCTTCATGTAATGGACACTTTACATTTTCATACATTGAT
GAAGTATACAAGTTTCTGCATTAATAAATAAAAAAAATTAATGCTGATCTCATTTCATTC
CATTCAAGATTCACAAAGGATCGAGTTCTTCCTATTTGAGGTAAATGAATCCTCATTAAA
GGACTTGTGTTGTGTGAGGTGAGTTCTGCTAACCTGGAATCAAAATCAATTGATATTATT
CACTTTTCCAATTTGCAGTTATTTGTTTTGTAAAGATTTGTGGGGTAAAACTGAATTCAG
CAAGGATTGACTGTTTTTGTTATTATGGAATTATTTATATAATGTTTTACAAAGTATATT
AAGTGTGTATGTTTATGTTGTGTTTTAGTGTCTTTTTTTCTACCTCAGCCCAGATGTTGT
TTCTGTATATGTGCAACATTAATAAATAAAACCTTCTGTTTAACATTGTGTTTTGTATGT
GGTTGTTTTATGGCCTATTAAAAAGCAGTTGAATATTTTGTGGTTCATGGCATGAAAAGA
AAGTTGTAGTAAAACTATTTCTTATTTTCCTTTTCTCGCACAGCAATTTCCACAAGCTAG
ACTGTTGTTTTTGTTAATTCCTCATGCGCTACAGGACAATAAGTCATAATAATGTCTTAA
TGTACAGTTATAAATTTATATAAAAAGGGTCAGTTCATTAATGCTTGGAAAACAATTGTA
TTGTCATTAGATGCCACAATAATTGGCATTTGGAGTTGTGTTGATGCATAGATCATCTTG
CTTATAAACGAGTAAATAGTTAATTGCCTTTTGTAATATATTTACAAGTTTTATTTTCAG
ATGATCTCATAGTGGGTTGAACTAACTATATGCAGTGTCTAAGATTATGGGATGGCAGGG
TCCGAACTAGAATTATAACATTCAAACTAAGATTTAAGATTTACATTGATATACAGATAA
CATTGCTAAAGAGTTTAAAGACCTGATGAATAGTAGTAAAGCATAATATTTGCAATGCTT
TTTTATTGTTAAATTAGAGGTGATTCTGGAATTAAAACACTTCATGTGACAGCACCTCAT
ATAAAACCTAAAGCATTCCCATTGAGGTCATGTTATTTGTTGAGTACACAGTAACAGCTG
TACACTGGGGAAAAAAAAAGACAAGGGTTCCACACAATCAATTTGTGTTGGGACAACAAG
AAGGAAAAAAAATGTAAGTGGATTGAACACAATAGAACTATGTTGTCACAAAAAAACAAG
AATTTTGTTTTAAGCTTATTTTAATAAAGTAGCTTAAAGGTGTTTTTGAGTGCAATACAA
ACCTGCTTGCAAACCATAATAATTATGTGGAGTATGAACACATTTTGATTTATTACGAAA
TAATTCTATTGACCGATTTGGTAGATTTTATAGGTTTATAAACAAAAAGTGTTTATAGAA
AGCAGAATAAATGTAAGTGTTTCCTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1116, 1441..1546, 1887..1937, 2348..2687
NC_007113.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved