Danio_rerio Locus eif4a2
snOPY snoRNA Orthological Gene Database
Danio_rerio eif4a2
Danio_rerio
eif4a2
2
SNORD2, SNORD2, SNORA81, SNORA81, SNORD2
5768..5838, 6148..6218, 6421..6599, 8603..8792, 9079..9150
13457
agatgctggctagacattgaattttgttcacttgacatcacaacctaaatctaacctaa
tattaacgtcttatgactttgtgtgcctacgcactacagaatgttacgtttacacacaca
tgcacaaattatatgtaaacgcatcagctttctacagcgtaatactcactacccacttct
cttgagtactttagaaaggcccactttttactcatcctttgagtaatatttacaacagat
acttttactctatttacactacatttttgggcaagtaatggtacttttacttgggtatga
ttattcagtactctttccaccagatttatattgatattttgtttctctatttttttcagt
aatttatttttgtgcatagatgttttactatgtagtgtagtgttattaatcctttggcaa
cataattaataatttcatcatgcccaaaaactacttgaatctgaatcacatgtataggtt
ttaggggtcaagtagttttgagcatttagagaaaaaagaagggaaaaagagcatactgca
cgagcaaaaaagcataataatcccacttatttttaattttgaactgtcatttaacattcc
atttcattttgtttatacaataaaagaaaatggcaattgatggtaccaaatggtgaccta
tttttgaattccacaaaagaggaaagatacacttttagttttttatttattttacagggt
gtactgtccctttaagtcccattttaaggccaggaatgtggagaccccgtagcgactcca
ctacactctatcaatggtgcaatatccttgcgcttctcaatatagttccatgcaaacttc
gatataacaagtacaaacactcacaaaattaaaacatatgcaactggaattacatctctt
gtcacgaccgataaaatgttgtgtcgcgtttagctctttctgcgtgtttgcggttttagt
ttaaatgtacaaaaataagatccggtacgataaaatcgccgGAGATTCACATGTTCTGCC
TTTCCGAGTGAATGCCGAAGTCGCGAACGGACCATGTCTAGCGGTTCTGCTGATTACAAC
AGgtataacccccagtgacgattaacttgaatgcattttatttcatactatgtcagtata
tttgtgttttgttgaactggggatgcgctaagctatttataacactggtattgtgtattt
tgacatggcgcgtttgatattaagcaggccgcacagctaacggctgttagctgcgaatga
ttaccttgcatgcgtgttgtatctgaaagccaaatgaatttatcagttgattttatgcac
agtaattatatttaaatagttcatgttattgacattgatgtgtgtcgaaacgacaaccat
tatataggcttcacgcccaccctgaaatccaacgcgtggcctccatgcgtgagtccttgc
atgtataccacctaacttagtgttaacttaccataaggttttgtttcttacttgttctat
ttttaagtcgagttattacagggaagcacataataggttatatactaacgttatatccat
gcacagcgaaacccgcttttaatgcgtcagacattaccagctgtttgcactgtaacgtta
aatgagactcaccaaatttgggcgtaggcttttaaggtaacttaacttaggccatgagct
tataacgttacgcgaagtttcacgacatgcaacttattttgttaaacgttttgatcgtta
actgtcgtccacgtggtatttttgcaatgtgcgcccaccaacatcccgtggaggttcgag
tcctgttagtctcgtcaaattaataaggttaaattgtttttttcacacgttagtactttc
ttaatatagtttcagaaattgattcctcgcaaattctaaagagtaaaatcatattagcag
ccaatgactatcaaagtacaacattgttcacaggcaaatagtgctaatgctgttttgaag
tcatgcttgcatgtgatttcagactttttatttaaaggggtggttcactataatatcatt
ttaaactttagctgatttgtaatgatgttgtgttaaaacaaacaacatctctgaatgtta
aaatccgttcaatgcaaagcgagacaattggcttttacagagttctcttagcaaagccta
cagtgaacggatgtttgaagactacaaagaaatacatctgggttaatgtcaaaccgttca
gattatgcacatacactgtgcagtgaaggggtgtggccagaggcactgtaatgttataac
acccctcctggtgatgtggagctgatctgtgaatctccgcaagttagctgaccaatcaga
gcctcttggggcgggcctttcagaggaattgggaaatgtgatagacgttctcatgttagc
ggagtagctaagcataatcaaaggataacttaaaaaataacattatttttacaaatgaag
catgagccaacattgctttgcatcttacaaacactaccgagccttaaaagtaccctgtgg
accaccccgttaaagttaaacaataatgagagcatgtcacaaattgccactgaatgactg
cgaatataaaaccaactttacctcaatcgtcaaattcagtaactcttaaaactccatatt
ttttatttatttattttttcttttagCTCACGAGATCGAGACCATGGGGGGCCTGAAGGA
ATGGAGCCTGATGGTGTCATCGAGgttggtattaatctatttgttgggatgggatggtgg
tttcatttttagctcttttaaaaggattgagcaataattttattaaaaggattattattt
ttttattgtataatgtgccaagcaaagcttactctatattttttttaaccaagcaaaatt
cttttgactaatattccatatccatgattttgacgcggcacatcaaaacaaaaaacgagc
atgaggcatttctttaaaaattatgttttgcgtgttggtgtgcaggattacattggtgcc
tttttatttatccacaaggcgttaaatgtcaatggaaaatgcaagcataaagagtcatcg
tgtgagcgggccttaagatgtgcgaataagcagcttttcaattcaatgagtcaaagagaa
caaaatcatcaaatatcaaaagttaaaactgaatttgctgcagtaggagaagctgcgtga
atcttttccttgtttaataaatgacttgcgcctcacaagtcgatgctgtcatgcaatgaa
catgtggtggtgcttgagacgcagagcacagatgctcttaacagttctgaaggtcattaa
tataacactaatactgaaactgttaaggcgttttagaatgaccaaaacatttcagaccct
ttacaatatgcctgcttttgtccgttcacacacattatcgtcacatgatctctaaagaat
tcacatgactttttgtaatgcgcatactgtaatttgttcggtaccaagcatgtttttttt
tatacatttttaaaactagcacataaaaataggtggatgaaatatagctagagtatcaca
ttgcatcctaggacatatgtgctggagtggacaaattcgatttgctccccttttcaaaat
ataagggtatgtccatgtaaactttcctcagtcactagaagttgaatgcactttaaaatt
tcctccgagggaacaagtgaggggaagtttgtgagtgtactggaatgcagccttgcactt
tctgaagtgcactaaatcccacattgcactgcaataagtgtatgacccttgtacagtgca
acattctgcaatacggaagtgcgctttttttgtatattattattattataattttttttt
attgaacttctcatttgggtgcctatgggagaaatgactttataaatgacagaaaacagt
caaactacttgctctacaaacaagcaagtttatgtatttaattccattcaatctgtcagc
gcaatccattttagctttaagattccctatcaattaataatgaattaatggttctgcttt
tcttcaaagcacttgaacgcaccaacctcatatactatttgagaagtttggaatggggac
tttctgacatcaaatgcagccagcaaagaatgtttgttcccacttaattttcaaacaatt
ctttccgtgttttttttttttttttttttttcaatcatttgaagcaacaattaccccctc
tttgatgcaatttgtcaatctaggtttttcctgtcgcacagtgggtgttaaagttgtaga
atttttatcaaaaggaaattgttattgttttagatttttcttctatattatcattattat
tattatttatatattttaccttgtacatttattgctgttaatgacttaattcttagaata
tttttacttgatctattttcattttgccattacatagccatagacgctaaaatggcaata
aaattaaaactctctctctcacacagtgtgttattacataaattttgaagtgagattaat
atccaaaaacaagtgacatgcatgtgtacatgcattgtcatcagaccttccgcatttaaa
tcaaggctgcacttaaatcttgctttttaactggtcattttgaggttgttggacttcatg
ttaagttctcaatatttgttacagtctgtccttagtttgattaacctttttttcaaaatc
ttttatcttctttaaccctcaaatgggatcaaggtagagtaagctatagttcttgtcaga
gatttggtggagaattcatacaaagttttagtggactttgtgcagttataaaaaaaaatg
ctacccctgactaacatcttggaaataaaaaatcaacaaactttgattgattgacatcgc
agaatatagaaagtgatagcttaacttgatgtctactccaaataaatgcaatagccttaa
gttggagaatttctaatattgaagtaagatgttcaacatttaagtgtaatcaatctgatt
ctcattgaatctcatatacattgttttacagAGCAACTGGAATGAGATTACGGACAATTT
CGATGACATGAACTTGAAGGAAACTCTCCTTCGTGGAATATATGCATATGGTTTTGAGAA
ACCCTCAGCAATTCAGCAGAGAGCTATAATTCCCTGCATAAAAGGtaaagtgagctcaag
ttacaaatagtttttaattacctctctggtaatcaaactgtacatattgatccggtttta
gtattgctcatctctttgtagactaacagttaagtagtttccatttttgttgtcctttta
ttgatgcttgatttctccataggTTATGATGTTATCGCGCAGGCCCAATCAGGGACTGGT
AAAACGGCCACGTTTGCCATTTCCATCCTGCAGCAGCTGGAGATTGAGCAGAAAGAGACT
CAGGCTCTGGTCCTGGCACCAACCCGAGAGCTCGCTCAGCAGGTATGCTGTACCTGAGCT
CACAATAACACAATAAGATGTGTGTCTCAGACCAAGGCGGCATATTCTGGCAGTAGCCAA
ATTCAAGgtactcttttgctgttcttcctgctttatcagtcaataaatgtggattttgtt
tgtaatttgcataatttgatcatctgttcagcaggaagcagtcatccatgtagtttttcg
ggcagattaatcgatcaatcattctttaatgagctggattatttactgctagtgtttgga
aattaggttgttagactgccaggtgattttttttgacaattattgtaactgtatagagct
ttgcacaagtatgaaatgatggtatgactatctttcgggactgaccttttgtggagaaga
ccttttcaactgatcatacttgtccagtgctttgcattaatggtacacagtacttgtgtt
tactaggtgttcctttcatttaaactctgcatttttgtctatgctttagATTCAGAAGGT
AATCTTGGCTTTGGGTGACTACATGGGTGCTTCATGCCATGCCTGCATTGGAGGCACCAA
TGTGCGGAACGAAATGCAAAAGCTCCAGGCGGAGGCTCCGCACATTGTGGTTGGCACACC
AGGCCGTGTGTTTGACATGCTGAACAGGCGGTATCTGTgtaagtaatcgatacacataga
tttagtctgaaacaacatgcagggcaaagtatgaagtgatggcatcatctttcgggactg
acctgttatggagataatcactaatttaactgatcatactttttgaccagcttgtttgag
ctgtttaagcgtataagaagtaaaatacgtaatgttgtttacttccagCTCCCAAATGGA
TCAAGATGTTTGTCCTTGATGAAGCTGATGAAATGCTGAGCCGTGGCTTCAAGGATCAAA
TCTATGAGATTTTCCAGAAATTAAGCACAAACATTCAAgtaagtctagaatctttataga
ccccttctgctcaaaagaactgtgctaaaattgcagactccagggtctcctggtttatgc
gatgatgctagcagagtatcatgcggaagaagagcaatggctctgcgctggaaatgaaac
tgagttggacctctttcttaatgtccagtggcttatgtttcaaggctcagagcaacaaac
atattgattggaacacattgtggaagaaatactagcatcactatttttctttttctttca
taatggcagaatcataatcaaattaactcttattaaaactgtgttgaattgcaagataat
acatatcaatcttgagctgcacaatattgtgttccaccattagttgttgtacttgcacat
gccatgtaatatgaatgcaggagatgtcagttttcactgcttgtgcttttgtagttcact
aaaagaccatatctacccatttaaaaaaaaaaaaaaaaaaaaaagcttttttaaatggtt
gttttcaggcccccagagtgccgttttgtgaatgaatgtctcaatcttgtgcatctttta
tttcatatgatcatgtaaagaacatggtcatcacaggattcatactagaatatcttgaat
ataatggaattttaaaatctccttttcagacattaaaaatatggctattccaattcatgg
gatatcaggaacctttttttgctttttagtttttaccactgttaaacattttattttttt
cacatgttttgccaactggtactgttgagctatttttcagcgccatttgaatcctttcaa
attcatcatttaagtcagtggttcccaattggaaccttacaagcaaattaccttaagtca
ctggaacttaagtcaaatgcagtcatgaagctgtacctgttaactgaagcaaacatgcca
ggaaaatgtcagcttcaagaactttggctacgaaatggccacttcagacaattggtctta
tgctgtgttcatgccagacgtggataaagcttcgagtgcaagtgatttacatgtcaattc
aatgcacagttgcgattaggctctagttggaaaatctgaacttaagtggacattcgtgct
gttaaccaatcagaagcttgctcttgtagtggattgataatgacgtagtgcctgttgtag
gtgacctgaggggaaatcctcttgctggcaccggacaacagctcataaagctgggttcgg
ctcagtctgaagcactgctaaaagcttccatccatgtgaagtttctgaaggagtttgagc
tctcagagctgggtggacctcagaaaggatccagtgaactcgcaccctattcacattggg
cttcaaaggttccaattcactttgaatgaatgaggtcaggcgttgccgaactgcattgtg
gctatgtcggcggcgcttcagtggcgttgctcactgcagaagttgggactcaacttttca
agcgccagcataagcgtcagccaatcagatagctgtatgcaaatacaccagctcagactg
tagcagattgctgactaatttcattggctgacgctgctatgatgattgcataagccccaa
cttcagacacgccctctgtcaagcgttgacgctgaggccccgtgagaatggggcgtcagg
cactgtgctaaacgaatctgtgctgtttgtgtccatttacgatcgaatagcctgactttt
tttctttggttccatgtctggtgtacacagtataagaccaagtgctctatttttattttt
tgtaattttctatttgaagtctgaaaaattaaccaaactattttaatattacatggtcat
ctttagtttaaccatggaaatttaggtttttagtctgttaaagtcagggaatgtgaattt
atttttattttttaatgtgttcatgcagctcacggtaattttccccttagttattcatat
taacgcattacacattatggtttcaaaaacaacatactttgtagcttcttttctaacgtt
ttggctctaatcggtctctgtttccagGTTGTGCTGCTTTCGGCCACCATGCCTGCTGAT
GTGCTGGAGGTGACCACCAAGTTCATGCGTGAACCTGTCCGCATCCTGGTGAAAAAGGAG
GAGCTGACTCTGGAGGGTATTAAGCAGTTTTACATCAATGTAGAACGAGAGgtgaggcac
tggctgtctctaatgtctcttgtcccttctttttaaaaagcgccatgctaaaaccaccag
gtcgatgctttcgggtctcgctctggtgttcatgctagtactggttaaatcacaaagaag
gaagagcaaaaagcacacagtcggaaatgagtctaggacggacctctttcttaatgtccg
gtgtccgaggtctcaagattttgtgccacatgcatcataaaaagccagaatatctataaa
tgatgtctctgcgctgtttgccctgctaacgtaaattgacttgttctgcagGAGTGGAAG
TTGGACACGCTGTGCGACCTCTATGAGACCCTGACAATCACGCAGGCTGTTATCTTCTTG
AACACAAGAAGAAAGGTTGACTGGCTGACCGAGAAAATGCATGCCAGGGATTTCACCGTG
TCTGCTTTGgtaagttcaagacgtataggtgcacgctaatctgattgagctactattgca
gattgatgatttaagccaggtatgaagtgatgcacgtcatctttcgggactgacctctca
tggagagaacatttcgacttactgatcatacttgtctaggtcttatgatttagctaatca
attggttgttttataagttaagaatttgtcttttttttattaaaagCATGGAGACATGGA
TCAGAAGGAGCGAGACATAATAATGAGAGAGTTTAGGTCTGGCTCCAGCAGAGTGCTCAT
TACTACAGATTTGTTGgtgagtaggaccccgtggataccctgggcttaaagtcttattgt
cttcaattttaaaatcaatttttaggccttaaagtcactgaaatattgtattgtaggtct
taaatcaattttcccatgtccatgaaaagcaacccaatcgagccaacacccattcaatca
ctatcattccatcgcagtaaaagtttattcaactcttatttattaactttatttagcaac
tcttatatttgtttataaatgtggtttaattatcttccttactataatgtttgagcttta
ttttttatgtttgaactaggccattagaaataatccttggtatttagctttgtggaagtc
tgaaatttcttatataatggacttaaagtcttaaatttgacttgaaaccctgaagccaga
aaaaggcgttcttatagtacaatatgatgaaataagagtacagtatagtgtctgtcggtt
tctatttattttttacatttttagcattgttacttttttaaattatggaaaagttaaatg
tgatttttttttttttttttttacagaacccactggttcttggtctacaagtaatgtaat
ttgtgtagtttggtttatttttttaaatttttatataccccaaattagtacaagcagcaa
aaattttttctttttgatatttggtgccagttaatcatttaggtgacatttgcacgcatt
tgttttacttgttagatgccagcggtgctttatttgcaaaggttttatgcgcttccagtt
ttgcactagtttcatttgtatatttgaatgcaaatgtagctattgaaaattaagtctgga
atcagttttaaagattagggctgcacaatatatcgtttgagcattaatatcgcagtgcat
gtatccgcaacagtcacattgcaggatttgattgttcattaaagattaaaagatgaagac
attaataaatataattatttttaaatggtttatataatgaaaaccatgttgttgggtttt
aatttctctacctgaactgtaatgctgcattcacaccagatgcggatgaagcgtcaggca
taagtcagtctaaagcactgctgaaagcctccagtttctgcaggagttgaactctcagag
ctgggtgtactgatttagtggattcagacacggcgccgaacaaatatacactttttcagc
ctttttagagtacaaacacagctactcattctataaaagccatattagccatttcacaat
gaagctagagtcactgggcacaaaaccactgcccatgatgcaaatccgcatattgtgaag
tgagtttactcgcttattcgagtgtcaaattttattgttcacttgtccatttacatgcga
atagcatgatttatttgcaatttttataaatcgcgcatgccctgtctcgtgtgaacagca
ttagactccagaaaaccataaagcactgtttatttgacttatttttgctctgttgtattt
attttagggttgtcacgatactgcaacagagtaccaatcaatgctgaaattttaaaacgt
ccatttcccgcgaacatttaagttcgttcttaaatggcactgatttgccatgatgttcac
atgctcaacagaaatgactgattagccgtaaaggtcatttttatcgccgtttactctaac
cgcagatacagggacactggagcatttcaaagtcacatcgatcagctggtttgtttataa
gctgacatgcaagtaatctattgaattgtggcttcgaagcactccagtgtccctgtatct
gtggttacactgtaaacggcggtaaactgatgaccttcactgccaagcatggtcatttct
gttgagcatgtgaacgcaatggcaaatcagctcagtctaaaaacaagctggacagcgaga
aatggattttttttttttttttaaatgtcagaatcgattggtaccaaattccactattgt
gacaaccataattttatataagattgtaattactgctaatgcactgcctaaagactttat
catcccaatcgatctaaacgaatgaaagctttccaaaaagaatttcaattcatctagtaa
aatgttactcctatagcaatacttgttgcagaaaaacaaaatattgcaatgtcagatgtt
tccaatattctgcagccctactaaagaagtttcataatcctgaattttacttaataaata
gctgcaatagcattaaattgcatttaattttgttcatttgatcttgactgacctaaaccc
tcattcttcagGCTCGTGGAATTGATGTTCAGCAAGTTTCGCTTGTCATCAACTATGACT
TGCCTACAAATCGAGAGAACTACATCCATAGgtgagggatccatctgttgttttatttcc
tctgactgcgttttagtttgtgaattcaacgtgaataaatttacaaatgctttttcagGA
TTGGCCGCGGAGGTCGGTTTGGAAGAAAAGGCGTAGCTATTAATTTCGTTACTGAGGAAG
ACAAAAGGATTCTTCGAGACATCGAGACGTTTTACAACACCACCGTTGAGGAGATGCCCA
TGAATGTCGCTGACCTGATTTAAACTCCTGGGGTTTTAATGTGGGGATTAGCTGTTGAAT
GATCACTTCCATTTGCGCTTATTTTATTGGAAGAAAAATATATAAAAACGACTCTCCTCG
ATGCTGGCTGCGGATCCGACCTGCGAATTTGATACGTGACGTTGACTCTGTGTGGACGGT
TGTAGACTCCAACCATTTCAGTATTCACTGGTGGTGGCGTATGCAAAACATGGGTTCTTT
ATTCTTTTTCAGGTATTTTTTCCTTAGTGTGTTTAAAATGTACTTGTTAGATGTTCTTCA
TCGTTTAGTAATTTACTTGTGGACTAAAAGATACAAGTGTTGCATTAAATCTGCCAATTA
TGTTATGCTAACATTCGTGTGCAGTTTAACTGTTCACTTCACCTACCCTTTTAGTAATAT
ATAAAGGCACTTTTCAGTTTTGTGGAATGTATTAATTTAAATGTATATTATTTTATCAAG
TCCTTTTTTCTGTGATGTCCTCTTTAAAGTTGGGTTATTACAGTATTCCATGTAGGGTTT
GGCCCATTTGACAATAAACAGGATGATAATTCTGTCCAtttacttgtcccatgtgttctg
aattatttttctgatcttgctttggcacattcataagatcagaagcgtcaaataaataca
aaagcatcctcatttgtttaccacaaggttttaggtgttatgtcataaaatggccactgg
gtgactcccttgtgcatctaactcagagaacgggaaccaaatatgaaatcctgactaacc
gactcaactttacaacgtgtcaagaatagaaaaacgtttgtacttagtttaagtgttgtg
gaatatttgatgccgttttgtgggggaaattgctcgcaaattgggaaaataatagtttct
gtcagggtaaacaattgaagggggtgttcaaatgaaaactgccatcttccatttagggtt
ttaagcattttaccgatgtctgccaaatttcagtcaggtttagttcataacactgtttaa
tgggtttgtgacggtcaaccggtttgaatggtgtttgttatccatctttaaatctttttt
tttttttttttttcatttcaattgaaattactttcattggaaagttaaacagaaaccggt
taaggcaagaaaagttgggattcggaacaaaaccgcctcaagcaacaagttaattttact
tggctagaaaacccatatgttgactaaaagtgagagtaaactcgttaccttgtaaataat
tgtcaactagcttcacattgtgggaggcgaaacgtaaaacctgttattaccctcatgctg
tacccaactcctgagactttcgacacaaaaattacaacgttttaggtatttagctgatag
gacaaagatgctttaaataagttgtgacacaataatgaagtaattgtcctttgtggcacg
tttacataacttctcggaattttgtactgatatgacaacacatttctttttagcaatagt
ctatatgatagtgactcacgagtgggctactccgatccggtagcagcttctttaatcaac
acgcctgaaaaatataac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 2666..2723, 5011..5144, 5303..5526, 5929..6097, 6288..6397, 8427..8570, 8871..9008, 9226..9315, 11591..11670, 11758..12457
5962..6097, 6288..6397, 8427..8570, 8871..9008, 9226..9315, 11591..11670, 11758..11902
NC_007113.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved