Danio_rerio Locus Rpl37
snOPY snoRNA Orthological Gene Database
Danio_rerio Rpl37
Danio_rerio
Rpl37
SNORD72, SNORD72
6603..6681, 7759..7836
9317
TCATGCTGTGAGACGACAGTGCCAACCACTGCGGCACTGCGTCACCCAAAATTGACATC
TAGACAACGGATTACAAATGTTTTAGCCCCAACTAATACACAGACACACACATTCACCCT
CACACATTCTTTTAAAATGATTAGCATTTTTACTTTGCCGTTTTATTGACTCCCTAATAA
TGTCATTTGCCTTATTAGTAAAAGATAATTGGGATTTTTATATCATATTTTTGTGAATTA
CAAATACACACACCTGGCCAATCATAGAAACGGCACCTCAAATAACCCTTGCTTTGTCTT
GCTTTGACATCAGAAGATTGCGGCAGCCTATGAAGGTCATTTTGTTTTATGTCCCATGCA
GGGACGGTCGGAGTCCAGACATTTTTGTCAGCTCTGTAATTTATGATGGTTGCCTGTGGT
GATTGTGAGCCGTTACTGTTTAAAAACCATTAATAAAAGACAAGGAAATAAATCAATGTT
TTATTTTTAAACACTGTTTTATTTTTTATGATTAAATTAAGTTAATTATAATGACTACAT
AAAACCCTATCAAAGAGACAGCTCACCAAAAAAATGTACATACTCTCCCTGAAGTGGTTC
CAAACATTTTTGAGTTTCTTTATTCGGTAGAATACACAATAAGATATTTTGAAAGCTACT
ATGGAAGTCAATGGTTACAGCTTTCTTCAAAATATTCTTCAAAAAAGCGTTCTCAAGAAA
ATAAGTAAAAGGCGAGAAAATATTGACTTAATTTTCAATTTTGTGTGAACTGTCCCTTCA
ACTTTCCATCTGTTTAATTTCGGACACTTAGGACTGATAAAATATTAGTAAATGTTTATA
TATGTATCACAGCTTCCACTTTATCAATATCACCTATGATCTAGATAAACCAGCAAATTA
ACCAGTGATAAAACGTTTTTTAGTCGTCGTCGTTCATCAACTTATGGATGCAGAAGCCTG
CAGTAACAGTATGGGGACATTTATAGTCGTTACACCAAAAGCGCGCCGGTGGTGTTTTAA
TGGTACACCAGCGTCTTTTCCGGTCTCTTTCGAATCAGCTCTGAGGAAAGATGGTGAGTT
TCTCAGCGCCTTGCCCTCAAAATCCTCTAACATCTGGTTCATAATTTGTTTTAAAATACT
GTACCTTTATTAATATCACAACCATATGTATTCGGTTTTCAATATTATATGTTATGATTG
TAGCTCTTTAGGTTTTGAGTGTTATTGATGATCTTTTAAAATAAGCTAGCATGTCGCTTA
GCCTCCCCGTTCATTTACTGGCGAGCTCGCGAAAACATACCGGGTCGCTATTACATCTTC
AGTGTTTAAATGAACGGTTAACACGCAAAATTGAGACTTGATGAATATGAGAGCGTCTGA
ATTCGTTAATTAATCTAACACCATCATTATGAAGTGAATTGTGTGGCTAATGCTACGTTC
TTCGTACGAGTAATTGAGGTAAAGTTGGTTTTATATTTTCACATTCGTTCATGTAACTGT
CTCTATTGTTTTTACCACCCTAATTTGAATATTCGGTCAGAATTAGCATGCAAGTATGAC
TTTAAAACAACATTAGCACTATCTAACTGACTGTAAACATGGTTGTATTTTGATAATCAT
TGACTGCTAATATGATTTCCCTATTTAGAATTTGTAAAGAATACTTTTCTCAAATCATAT
TATTAAGGAGAATGTCTGAATACCCGAATATAAAACCAACTTTACCTCTATGTACGAGTA
ACAGTTATGCTTGCAAACATTTCAAGAGCCTGGTAAACTATTCAAATATAATCGTAATGT
TTACTACAAATGAAGATTTGCTTGGCATAGCCTCAGCCTGTTTTTTTTTACTAACTTGCT
GCAAATTACCATCATCACCAAGAGTCAAATGGGATAAATTAAAAACTAAACACTGCTAAC
GTTATATATGAATGCTGCCATTTATAATGCTACATTTTTTAATATAACCTTTCATGCAGT
GTGTAATGTAAATTGACATGCAAAGTTTTCAAATCATAGTGCACAACTAATAAAGTTATG
GTCTCCTGTCAATTAGTTCTTAACTGCCTGATTGAAGTCATTTATTTGCGTTATAATAAT
AAAAATAAGTGACTAAATGAGTTTTCTGATTTATATATGTTTGTCTGCAAACATCAGAAC
CTGTATTCTAGTACAAACATAGGAAGTCAGTTTTTAGTTGCCTGCTAATTTTATTTATTA
ATGTTAATGATTACCAATGAAGAATTGCATAATATTATCCTCAGCCTGTGCCTTTTTTAA
TACAGCAACTCGCCAACAGATAAATAAAATAAAAAACACTGCTATATGAATGCTCCTATT
TATAATTCTTAATTTTTGAATATACCGTTCATGCAGTGTGTAATGTAAATTGGTATGCAA
AGTTTTTAAATCATAGTGCACAACAAATGAAGCCTCGAATTAATTCACTGCCTCGTTATT
TTAATTGCGTAATATTAAAATAAATGGTTAAACGATTTTTCTGATCTATATATTCTTGTC
TGCAAACATGCTTCAGAGCCTGTTAAACTATTTTAGTATAAGCTTATGAATTCAGTTTCT
AGTTGCCTGCTAAATGTTTACTACTAATAAAGATTTGCTTTGCATCATATCCTCAGCCTG
TTTAAGTACAGCAAAAAAAAAAATTATATGAATGCTGCTATTTATAATGCTCAATTTTTA
AATATTGCCTATCATGCGGTAATGTAAATTGGCAAAGTTTTTAAATCATGGTGCACAACA
AATAAACATAATGGTCTCCTGACAGAGTTAATTCTTAACTGTCTGAATAACATGTCAGTA
TTGCAAGCGGTATCAAATTATGATTATGGTAGTTTGTGGTTTTCATTGATTGCCTTTAAA
CGGTACTTTTACCCTCTTGTCTCAAACACCCTCACCAACTTACCTTTGCATAAAGTAGCT
TAAAATTGTGGTAAAGTTGTTTTTCTCTTCGCACTTAATTTTACTTCATTAATTTTTTTT
AAACAGTGACAACTTATTTAACACTTTGAATATTCGATCTGAAATCGCTGTGCTCTCATA
GTGGGAAAATGGAACAAAATCTTGCGGCACATTTACAGGGGTGATAGCGTTCCGGCACCA
CGCCGGATTTCCGGCGTACTGTGGCTGCGGGAAAAAAAAAATCAGGTTCACGGATATTGA
TCTGTCATTTCTCTAGATTCACAGAATTCACTCACTGCTGAAAGCGCCGGATTGGTTTTT
ATTAAGTGCCATTTTGTGTGCTCGTGAATCATCTTTTGAGTGTAGACGCCATGTAAATAA
AAGATTAATTGTGTAATTTAGAGAGCTTTATAAATTATAACGGATCTTTGTGAGATCTCT
ATGAACTAAGATTAGTGACGCTTTTTAGTGATAATAAGGGGAGCGTGCTTTGCACTTTCC
AGGCTATAATCCATTCAGAATTTGTATGAAACTTTCGTTTTCGGCACATATACGCTGATA
TGTTTTGGGAATGACATCTGCATATTTACGCTGGGTTTATTCTCGAAATAACGGTGAAGC
AATAGACGGGACAAAAATATATTTCCCCCTTCTCCTTAAACAACTTAGTGTTTCTGCTAT
GAAATAGTTCAGTTTTGTATGTAGCCTAATGGCAAAGTGTTTATATTTAGTTTCGTTTTT
ATTCAGCTTATTTAGAAAAACGTTTGGAGCATTTTTTTATTCGTTAAAAATATATATTTT
TTTTTATCGAACAGCGCCCAGCGGAAGACCATCATTGTCTGTTTGATCAGTTTGCCTTCT
CAGATCATCACGACTTGCCTAAAATAAAAGATATAAAACAGTTCAAGTATAAAACAATGG
TAGCTTAAACGTTAAAGAATGTGTGCTATTAGGCGCATAGTTTGCTTATAAAAAGCTTGC
AGGACATCGAGGCGCCAGAGCAATCACTTGCATTTTTTTAGTGGGAGCAATTTAAAGTTA
TCCGTCATTTTTGCTCACAAAGTACGAGTAATACATCAAAAAACGTTACAGCGTTTTTAT
AAAATAAAGAAAACCAAAATTATGCGCTTTCTGTCGTCTGGTTTTTGAACAGGAGCGCTT
AACAAAATGAAGCAAAATGTATATGCCTCACAGACATAATAAATATATTTATAGAAAGCT
TTAAATTATTACTTAACGAAATAAAACAAATCGAAAACAAAAAAACTCCTTCATGTAATC
CGTAAAGATGAATTTCACTCTAAAGGCGAGTCCAAGAGGAGATTGCCAGTCAGGATCTTT
GCGACACTGACTCAGAATAAGTTTATTAATTAGTAATTAAGATATGTCCTTACTCTTTCC
TCGACACATTCAATGTTATTTGTTTTTGCCGGTGCTTGGGGCGAGTTTTAGCTTATTGTG
TGCGCTTGAACGCGGATTCACAGTAGCAGTTTTAACATGGAGTGACACGACATCTGACGT
ACAGATGACACTGGCACATGCCACTGAGTGAAGTGACACTTCCGGTGGCACGTCCGGGTT
TCCACTGTCATGTGTCACTCGCTAGTGGCATGTGTAGTGACCTGTGTCACTCAGAGTGTC
GCGCTGCATGTCACTGCAGTGACATCGACACCCGGCGAAGTTTATGACATTAATTAACAC
GAGCAAAACCATATTTAATCATTACGCGACTTTTAACCTAATTTATCGCGTCGCAAGTTA
GGCTACTCCACGATGTTTTAATTTAAACGCATTTATATTATGTATTCGTAGTCATACTTC
CGTACGTAATATAGTCATTTGACAGTACATGTCAGTCAAATTTATTGTGGCATGCTTATG
TATGGGAGGGGTTACACTTATCTGTTGTACTGTATATTATTGCATCCTGGCAGTTCCTTT
GTTCCCTACAATATGGACTTCTCTATGTTTTTAATTCATTCATTTATTTTATTATTTAAC
TTATTTTCATTTTAAGGTATTTTAAATAATATCCTTTAAAAAGTTATAATAAAATGCATG
TTGAAAACTCATAACATATATGCATGTAAGATAACAGGTGTCATTTGCCTAATGATTTTT
AAATATTAAAGCAAAGAGACTTAAAGATTAAGGTGCTTATAACGTGCTTATACTGACACC
TACTGGCACATGTCACAAGATCACTGACACTGGCAAGTGTCACTGACATTACTGGCATGT
GTCTAAAAAGAGCCACTTGACAATAATGATGATCAGGGTTACACACAGGCTGTTAATATA
TTTGGGCCCAGGGCCCCACAAGTTATGTGTTAAAAGTGCGTTGCATACATAGTACCCCCA
CCCCTACTCACCTCAGGGGCAAGGAAAAAAGTTCAGGCTCAGGAATTTTTTCCACTATCA
GCCCTGCATTTATAAACGCAACACTGATGACGCATGTCTCCAATTCTTCCACTTGTTTTA
ATTAAGGTTGGCAACACAACATGGGGTATTATAAGCTATCATGCATTTTAATAAAGTTAT
TATTAGTTATTATAATTAGTTCGAACTAAGGGTTTTCCATCAATTGATAAACTCAAAAGA
TGTAATGTTGTACGGGCCGGTACAGACATCCAGTCTCCACGCTGGCTCCACAAGGATCTC
ATGTGCGTGACGTTGCTTCAACTTCTTTTCAAACAGGAAGAACGAATTTGTTTGAAATAA
TGCAAAAACAACCGCTTTTAAGTAAAAGATCTGTGTCCTAATAGTGTTTTTAGCAACGTT
GGACATATACACGTCTGTCAACACCTCCAAAAATGTGTTTTGGTGTTTCGTAGCCCTTTA
AGGAAAAACCACGAGCTTGAGAATGTAAAAACCAACTTCACCTCAATTTCTTTATATGCA
TAATTTCAGGACTTTTTCCTTAATTTATATACATAAAACTTACATTTCATGAATTTCTTT
CCTATTCCAGACGAAGGGTACGTCGTCTTTCGGTAAGCGTCGTAATAAGACGCACACTCT
GTGCCGCCGCTGTGGATCCAAGGCTTATCATCTGCAGAAGTCCACCTGCGGCAAGTGTGG
ATACCCTGCCAAGCGCAAGAGAAAGTGTAAGTGTCCCTATGTTCAGGTTAAAGAGTTTGG
GTGTCCATCCTCGTTCTAGCCTAGCAGATTTAAGGAGCCCAAATTGGTGACATTTTTAAA
CAGGCCTACGTTTTTAGACTGAATTTTAGGGCTGCACAGTACTAGAAAAAATATACAATA
CCTATTATTTACTAAAAGTCATTTATTTGTGCAATGATGTTACACTTTTTTTTTTTATCT
AATTTTAATTCAGACTTTAAAAAAAAATCTGTTGAGGTGTAAAGATTTAGTCTATAAACA
TTTAGTGAAAACATCAGCAGGTATTCTGCTATTTATTCTCTGTTGTCTTTTTCATCATCT
TGAATCCCACCATTAGTGTTTACCTTCAGCTTTGGGCTGCTTCAGCCAATAGCAAAGCAG
AAACTACTGTGATGGCGGGGATAAAGATAGTAAGGCTCATCTGATTGGTCAAATTTAGAT
AGACAACCACTAGATATATTTTAATAAATAAATCAAGTCTGCAATATATTGCATGTACTA
TCGCAATAAAATATTGTGCTGATTGTGCAGCCCTACTCAATTTATAAGAAACCTGGCATT
AAAAGCTTACCAGTGATGTGCAAAAATAAATGTCTGAACAAATGAGTGTCCAGTGATAAC
TGATTTTGAACTGAGGTAAGCCTGAGGTGTGCCTGAACAGAAGCTGGACATGAGTCTTCT
GTCATTCGTTTAAAGTTTAATGATTGGTTTTGTTTGTAGACAACTGGAGCGCTAAGGCTA
AGAGACGCAGCACCACAGGAACCGGCCGCATGAGACACATGAAGGTTGTTTTCCGCAGGT
TCAGGTGAGTAATGTTGTGGTCTGATCAGATTTTCATGTTTTTGAGTCTTTGTTTTGACT
TGGAAGAAATGCAAGAACATTTAAGACTACACAAATTGATTAAACTCAATATATTCCAGT
TTTTTTCCCTCAATAACTTTTTAAAGTTATGATACTGTTGAAATTATTACCTTTTTGTGA
TTGTTAATGACACTAAGGAGCTCTTAGTTGTTTTGTAAGAATAAAGATTATTTTTTCAAA
CTTTGGTCTACTTTTGATGTCTAATTGAGTTGAAAAGTTGATTAAGGGCACAATTACGTT
AAACAGAAAAACAATTGTTTTATTTTTATTTGTAATCTAAAAGAGTTCTTACAATTAAAA
TAAGTTTGATAACTTAGTGGTTTGAAATTTTGGCAAATAAAGTACTAAACATTTTAATGC
ATTTAGAGGATTAAAAGTTTTTCTGCATTTTTTTTTAAAACCAGTCTTTATATTAATTTT
TATATAAATTCCTGCCATTGAAATGTGTTTTTTAGCATGTTATTCTTTGATACTGTGACG
TTCAAACTGTTGCTGGATGATTTAGTTGAATCAAATCCCACACAAGACTTTCCAAAAGGA
AAAGAGAAACCATTTTGTGACTCATGCAAGAATATTTTAACTGTAAAACACTTTAATGTG
TATTTTTAGACTATATTAGACAGATATTTTCTGACTAAAACATTAAATGGAAATGTTTAA
AATGGAGCCTTCTGTAATACTTTTACAATATTTATACTGTATATAACTTTTTATTGTCAT
CTTTTTTCTAAACATTTTGTAAATTACATGTTGAATTTTAGGTGTTAATTTTGTCATGAA
TAAACCCAGTGCAGCATTAAAACGCACAAATAAATGTAATCAACTACACGCCCAAATCTC
AAGTTAGCATCTGTAACATGGCTTACCAGTGATGTTCAAAAATAAATGTCTGAACAAATG
ACTGTCCAGTGATAACAGATTTGTACTGAGGTAAGCCTGATTCGTAGATTGGCTTTTGTT
AGGAAAGCCTTTTCTGTTATTATAAGAGTCTTAAACGCATGCCTCCAATCTTGCTCATGG
TTTTTTTTTACTATCTTTAGGACCATTAAAATGTATCTGCGCGTGATGTTTTGTTGACAA
GTCTGTTTTCTGTGCATTTCAGAAATGGATTCCGTGAGGGAACTGTTCCCAAACCCCGTC
GGGCAGCAGTGGCTGCGTCCAGCTCCTCATAACGTGTTTCCAATAAAAAGTGACGTTTGA
AATGTCTGTCTGAATACCTTAATTTTTTTTATATTAATATTCGGAAAAAAGCTCCTAGCA
CTTCACAATGCAAACTAAAGTCTTGATTTGAAAATGGTTTTATAATAAATCTAGTTTATT
AAGTATCTCCTATAGCTTCTTTGTCTTTTAAAAGATCATTATCCATTTAGTCAATATTTA
CCGCCCCAAATGTCCTCTTTACATACAGTTTGCTTTAGATATAACATTGGTTACACCACA
ATAAAAAAAGCAATCATTTATTTTAAAACTTTATTATTCAATTCAGGCACAATCTAAATA
CTTTTTTTCATACAAAAGTGTGAGTCAAACAGCCTTTTCTAAACACCTCAGTAACTCCAT
GCTGAGAATCACGTGACAAACATATATAAATAACAAACAGTGAGAGGTAAAGTGTGAGAC
AAACACTGTGAAAGTGGTCTGAAGTGATGAGGCCAACTGTGAAGTGATTCTGTAATGCAA
ATTATTAAACAGAACAAACCTGTTAGGAGTTGCTGCAGAAGTAAGCTGTGATCGTGAACT
TTAATACATGAAGTGTGTACTGTGAAGATGTGATGTGTTGCAGTTAAAACGGCAAGTGAA
CATTTCATAAGTGCACTGAAGCCAGAAAGATTAAATCCAGACTCAGCTCAACGAATTCTA
GAGTGAGAAAGGCTGAATCGAGTCTCGTTCTGGAGTTCTTCAGGATCTCTATGGAGAATG
AGCTCTAGACCCAGTATTGTTTGGTGGTGATAGGGGGTGCTTGGGGTCTGTGTTTTGGGA
CGTGGTTCTGGGTGACGTAACTTGGGTCGTAGTAATCCCATTCTAGAGCGGACGCCCAGG
CTGAGCCCGGAAATCCATCACTATCCATAGAGAGGATACGGAGAGAAACACCTAAATGAA
CAATTGGAAGAATACAAAGAATGGAAAAACTCTTAAGCAAACAGTTATAAATATATATTT
TAAATGGTCAAGTATGATCATATAAATACAAAAAATATAATGTAACTGAAGAAATAAAGC
CTCATGCTATCAGAACAATTACATTCATTAACAGTGACTACTAAAAACACTTTAATATAC
AAGCTAGGCCAGTGTTTCTCAACCATGTTCATGGAGGAACACCAGCTCTGAACTCTTGTC
TTAACGAGGTGTGCCACAGGCCTGCTTTTGGATGATGCTCCCAGCTATTAGATCGCTGGC
TTCAGTAGAAGTCATAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 5890..6025, 6759..6843, 8002..8317
1070..1072, 5890..6025, 6759..6843, 8002..8071
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved