Danio_rerio Locus RPL10
snOPY snoRNA Orthological Gene Database
Danio_rerio RPL10
Danio_rerio
RPL10
SNORA70, SNORA70
2719..2852, 3584..3717
5516
AAATACACAGAGGGTTGGTGAGGGTCACCAAAGACATAAAGGGATGGTGAGGGTCACTA
GAATACCTAACAATGAGTGCTGCTGAGGATTACTGCAATGTGCTGGACATGATACAGTGG
CAGATTTTGTTATGAAGACAAAGACTGCAGATGCTGATTCTGACTGAAATAAAGCTTGTC
ATCTTCAGGCATCTTTAGTCTCTCTCTTCTTTTTGTCTGCATTCTGCTTAGTCTTTAGTT
TGTAGCTCAAAAGCTTGAAGTTCAAAGTTAACATATTTAATGCAATTACAACAAGTTAAA
TTTGCATTACAACAGTTAACATAAAAATTAAACTGACATGTCACTTAACCAAAACTGGCC
ATAGTGCATGAGTGTGAGTATGAATGGAGAGCGTATGGGTGTTTCCAAGTATTGGGTTGC
GGCTGGAAGGGCATCCGCTGCATAAAACATATGCCGGAATAGTTGACGGTTTATTCCGCT
GTGGCAACCCCTGATAACCACCTGACTGCCTGAGGAAAATGAATGAATGAACGATGGTCT
ATTTTGTAGTGCAAGAGGACAAATTCACTAATAAAACAAGCCCGATTCCAGGATATAAGG
GTGCTTGACAATTAAGGTTTTAATTATCATATTGCCATATGATCCTTTTGTTAAAAATGT
TTATATAAAAATCTCCATCATTTTAAACAATGGACTGGAACTGGTAAAAAATAAAGCATC
ATTCCTGGAAGGACCCCATCGCGCTGATGGACTACAAATACCAGCAGACATATGAGCGAC
CGCACTACAAATCTCGCTTTGGCTAAAGCACAGAAAATGACAATCTTAAATGAATCTACA
GCACGCTTATGATTGTTTTAGGAAATACATTGATAAATGATTGTTAATTTCGCAAACTAG
ACTACAAAATCGGTTTTAAACGATATAAATACAACGCGAATATGTAACCGGAAGTAGTTT
CCCTCGTTGCATTATGACGCAGCGGAAAGGCAGTTTTCTTCCTTTCCTCCATTAGGTGAG
TGCGTGGTAAGAGCGCGGTGCTTTGCTCTCTTCCTTTTTGTCGAAAAAACACATTATTTT
TCCAATGATATACACGCGTTGTCCTTATTAAATCAATTGTTATTGTGTACGTTACAGATC
GCAACCATGGGCCGCCGTCCAGCCCGTTGGTAAGTTGTGAATTTGGTGTTTTAAAAAGTA
GCCGCAATGAAAATGGCAGGCCCCGCTAACCATGTGCAGCCCGCCGGCCACATACAAGGA
GTAGTGACAGGACACTCACGAGCTCTGCTTTCTGATACTAACAAGTGTTTATATAAAACA
ACTTTAAATTTAATTTAAATGCATGATAGGTTATTTGTTGGAAGAAGTGGTTTTGGTGTC
AGGCTAACAAATTAGCCTCCCAACAGTCACTTTAATGTTATTTGACATTTTTGCTGTTTG
CAGCGTAATAGTTAAATAAGATCTTATGGTAACTTTATAAACTGTCGTATATTCCTATAT
ATAAGAGTTTTAGTCTTGTTAATGGTCTACTGTCTTTTCCAGTTACAGATACTGTAAGAA
CAAGCCTTACCCCAAGTCCCGTTTCTGTCGAGGTGTTCCTGGTAAGCCATGTATTTTTTT
GGGGGGGGATGTAATGCTAATTGTCTTGTTGCATAAAACAAGAATGTTATTTTGTCCATT
TACTTAAAGTATATTTGTCAGCTCATGACTTAAATGTAACATTAGGGATAGTTTACTCAG
AAATAAAAAATTGCCATTTGCTTATCAAGTTGTTACAAACCTTTGAGTTTTTACTATCAA
ACAAGATATTTTGAAAGCTGTAAATTAGTAATTGTTGACTTTAACAGTATTAATTTTTTT
CTAAGGATGTCAATGTCTTCAGCTTTTTTGTGTCAAACGTAATAATTTTAATAAAATCAG
CATAAATGGCAAAAATCTAGCTGTAAAGATACGTTTTTGATCAAGTTTTACCATTTTCTG
TTCCAGGGACATTGGTTAACATGTTTACATGATCATTCTAACCTAGTTTAAGTATGTAAA
GTTGGTCTAGAATGTGTCTGTAAAAACGCTGTGGGAATGCAAAATGTGCGCATTAGTGTT
ATCTCTGTATAAATCAATCAGTTTAAGGTATGTTCTGTCTCTTTACCAAACTCAGATCCC
AAAATCAGGATCTTCGACTTGGGCAGGAAGAAGGCTAAGGTGGATGAGTTTCCCCTGTGT
GCTCACATGGTGTCTGATGAGTATGAGCAGCTGTCCAGTGAAGGTGAGAGATGCTGCGCT
TACTGAATTTTACAATTTGACATTACATTTCAAGCACTGTAGTTCTGGGTCATATTTAAA
ATATTATACAAAAAAATAAAAACTGCTCCTAACTTGCTTTTTTTTTGAGAGAATTGTAAA
AAAAAAAAATAATAAAATAAAATTTGGTGTCAGTCCTAAATTTTAGACTGTAATGTTATG
TATCTTTATTTATTTGCTTTGAGTATTTCACAAAGTAATTTAGTGCTAAAACTACTCCTA
AATCAGTGAGATGTTAGAGCACTGTAGAGGACTCCTAAAACACTAAGACCAAACCATAAA
CTTTCCTAAAGAGGCTGTTGCTGGCAATCTGCATTCGGAAAGGAAAACGTTTTTAAAAAT
TTGACTGAGCTTTTGAAAAGGTAAATCTTAAGTAATTATGCAAATATATTCTATAAGTAA
ATAGTATTTTTTATCTTCTCTGCAGCTTATTAAGCCGACTGGACAGGTTGTGTGTACTTG
TGTGGTGTGCAAAGGCTGCAGACAGTGAATCTTTGGTTGTGTATGAGCCTGGCTGGGTAG
TGCCGGGCCCTTTAAGGGACCATTGAAACATGCCATTGCTGAACATTAAAAAAAAGAGCA
TATGATTGTCAAGTTCTATTTTTACACATTTTGTATACCTTTTTAAATATTTAAAACCAT
TTAATATTTGCTAGATTTTAGAAAAATGCGTAAATTTTACATGGGAAGGATCTTTATTTA
ATGTCTAAAACATTTAAAAGCAAGGAACATACATTATACCACGCAATTATTATCTTCAGC
TGCATTTAAAATTTCTTTTAAAGTGACACTATTTAAAAAAACCTTTATTTGAATATAGCA
TCACTTTCTTAGCCAAGTTTCAATCTCTTGCGGAGACCCCTCCTATCCCTATCAGCCAAT
CACTGTACATAATTGGTAATCATGCTGACATCATCCATAGCAACAAGGTTAACCCCACTC
CTACTCTCCGCTTAAGACTTATAAACTCTTTATTCTGTAGTAAACATTTGTCTCAGCAGC
TTTGTGAATATCTTTTGAGAACTCTTAGATAATAACATTTAACTTTTCTTTAGAAAATCT
CTGTGTTGAGATGAAATTCTGATGATTTTTTTAATCCGCTGATTCATTTGTCTAGCTCTT
GAGGCTGCCCGTATCTGCGCCAACAAGTATATGGTGAAGACTTGCGGTAAAGATGGCTTC
CACATCCGTGTGCGCCTGCACCCCTTCCACGTCATCCGCATTAACAAAATGTTGTCCTGT
GCCGGAGCTGATAGGTGAGCTGCTGTTTGCTCTGATATACTCTACTGCAGCTTATTAAGC
CGACTGGACAGGTTGTGTGTACTTGTGTGGTGTGCAAAGGCTGCAGACAGTAAATCTTTG
GTTGTGTATGAGCCTAGCTGGGTAGTGCTGGGCCCTTTAAGGGACCATTGAAACATGCCA
TTGCTAAATTTATTTATATTTGTTTTACAAATTCGAGCACTTTTAAGGGAATTAAACTGA
GTTATGGTGTCTTCCAGGCTCCAGACTGGTATGCGTGGTGCGTTCGGGAAGCCTCAGGGC
ACAGTGGCCCGTGTGCACATTGGCCAGGTCATCATGTCTGTGCGCACAAAGGCCCAGAAC
AAGGAGCATGTGATCGAGGCTCTGAGGAGAGCCAAGTTCAAGTTCCCTGGCCGTCAGAAG
GTAATGCAACACAAATGAAAACTAAGTTGTAATTGTCAAGCGGTCGCTGATGTTGGGTTT
CTTTCTCTTTAGATCCACGTGTCCAAGAAGTATGGCTTCACAAAGTTCAACACGTGTGAC
TTTGATAACATGCTGGCGGAGAAGCGTCTGATTCCTGATGGCTGCGGGGTGAAATACATC
CCCAGCCGTGGACCCCTGAGCCGCTGGAAGGCCCTTCATGCCAACTAAGCACCTCACACT
TGCTTTCGTTTGTGTGAAAAAGGCTCAAATGACCACAAATAAAGTCCATTCTTTGATTTT
TCTAGTCTTGCTGTTGTTTTTCCAAGCTCTAAACTGAACACCTGTGGAAGTCCTAACTTG
TAGTTTTATTTTGAAATATAATTTATAATATTTTACCCAATTAACACTTTTAAAAATGTT
ATTTAAGATTCATAAACCCTTGTATAATTCAAATAGAATATCTGTTTCAGATGGAAATAA
CTGAGATGCATACTTTCATAAACAATTTAATGCTGCAATGGTATCTCTGTTTAGTAGATG
AGTTCATAAAAAAAAAAGTGAATTTAGTAAAAAGCTAAATATATTTCCAGTGTATTTGAT
GTTTTTTTTTTATTCAAAATAACTTGATTCCTTTAAAAAACTAATTGACATGCAAAGATA
CTTTGATTTCTCAGGTCTGACATGATCCAAACAAAATGTCACATTATTAAAAATATTGTT
ATTGTAAGTAATAAAAACATATAGGGTTTTATTTTCTAACTGATATGCAGGTGTCAATTT
ATCTGAATATTTTATATAAAAATATTGAATGTTTAATAAACGAAATGTATTTGATCCACA
GAAATAAAAACCATGACACGCTAGTGGGATTCAGAAAGTTCAATAGCGTCCCCTTCTGGA
ACATTTAACAGTAAGTAAAGTAGGACCAATTCAAGTGAACTTGTTAAAGGAATTGTTGAA
TTGTCAGATCACATTAAATGCATATTACAAAATAATTTTGCATTGCTTGGCTTTTGGTTT
AAGTTCTGTGAAACATTTTAAAAAATAAATAAAACAATCTTTCAAGAAAAATAACTTCCT
CTTTATCAGGCCACATCCTTCCGCTAGACAATTTTTGTTTTGTCACTTGAAACCTACATG
GATGACTTTCTGACTGGGCAAATTAAGCAACATGGAAACTTGTACATAATGTTCTTTTAT
CTTTCTTTTTTTCACTACATTTAACTACCTTCAATATAAAACAACTACCTTCAAAATTTC
CAGTAGAGGATGTAGAAAAAGCTTAGTTGATAAAAACATAAATGTAACGATAATAACAGA
AAAAAAAAAATCTTTTTTTACAAAAAAAAAGCATGCTGAAAATAACACCTGAGCCAATTC
ATCATTATATTCGAAAAGCCATAAAACACGCAAAGAATTTAATCTTCAGTCACTCTCCAA
CGCATTCTGAGCTCAAGTACAACAGAGCTGTGTAACAGCAGAGTATAGTCTTCATCTGGG
CCAGATGAATAATCCACTTGTAGTTCATACAATCATCTGCATGAGCAGTAAAGCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1137..1168, 1542..1600, 2155..2262, 3415..3553, 3797..3959, 4032..4251, 4502..4516
1146..1168, 1542..1600, 2155..2262, 3415..3553, 3797..3959, 4032..4187
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved