Danio_rerio Locus rps12
snOPY snoRNA Orthological Gene Database
Danio_rerio rps12
Danio_rerio
rps12
23
SNORD101, SNORD100
2285..2360, 2591..2675
5934
taaacccgggacatgtttggcccacatgatgcatgccagcgccgaatgaatggccctct
gaaatttccaccaacaatgagaattattctcagcctactttgtttacgttgagttatgtc
actttgaaaacaatgaaaataacttattctttgccaaaaaagtgaaattactgaaccttc
acactggagactgataaaaacgctcactttagaagaaaatttcagatggcttttagaggt
ttttgcatcttcatatataatttctgcatcaacattgtaatgtgattacagtggagcagc
accagtggagtccttgtaacattaaccattatagaatgaaagactatcatttgcctgcat
tttaaagtgaattttgggagcaaggaattacatttgcagctgtaacaaagataaattgta
tttgtttaggatgcagactctgcaatgttattttacagttaatgattaaattttagacct
cacaaaaaaacacaaagcacttagctgtgtatattatttctatcaattgtatttttctat
gcagataatcagataatatatgagatttcattttatcaagtgatgccctctcctacaaag
tcacgcaaatctaaaatcaaatactttccaaaaagagctagtcgaatcatctggtgacac
tatttatatgcaaaattgtagaaaaagtagcctaaaaatcatgtccatttataaatatct
tttccaacatagtgcaaaatggtagacatcacatcagcaacacctagttgtgcgtttaag
tattgttcaccgagaataataaaaagtacttaaatgttaaaacgatactgagcgatattt
attgaataaaataaatcagcaacactaaaactatacacaatgaaaacgctataaacagtg
ccgttgctttccacgcaggcaatgagttgaacaccaacggggccctttagcgcttaaagc
aatgttgtcgacactatgacgtcctctttacccgcagtcagAGGGAAGGTAGGGCGAGCT
TCTGAAATCTCTGACACAATCGGTCTTAAATATTAACCATCCTGCCTTTAAAATAACCCG
AGATGCATCCAAAGCAACGGATATTAATATATCCATCATATTATGTCTTTATTTCAGGAA
TAACTCCTCGCATCCATCGCTAATCTACAATGGCCGAGGAAGGgtgagtgactgatgcta
catcacccttcatagcatgcactgctccgttaagaacatttataaacgagtattacatta
tttaagtattaaaaaattatttataacctgtatgttatgaaacaattacttttcccctta
ctaatacaacttaatataacgagctgctgctcaaagaaaactaattgtaagttactagta
gcacatggctattattttaagccgatcctgtgttaaaagctttatggaccatattgattg
ttcccattcattttccttgtgataaaacactggtcagcttttttgtatgtataatacaca
tctatacacatccattctacaaaatagacacgagaaaattacttctattgttagttacct
ttagcatgagtgtacttggcaggtgtgactcaattacagggttattcatgagtattaaat
ctaattaaagtccatttcagaccttattctcgcttaaagggatagttcacagagaattta
cttcacctcatgggactcaatcttaattcctggagggcctcagctctgcacaattttgct
tcaacctgatcaaacagctgatccaaataatcaaggcattcaagagtcatgaacaccatt
agttggatcagctgtgtttgattagggttgaaaactgcagagcctcagccctcctggaat
tgagtctgagacctatgctctacctcatgtggttttaaacttgagtttatttctgttttt
ctaaaatggtagtgttcaatcagcattcttcaaactatctcaacagatgaatctcaaatt
gtgttttgaagaatggcactattttgggtggactatccttttaatggtgtgtttagtctt
gttgtaaagtttaaaaatgtaacttgtataaaaaaatgcattgtgtgctttctagttttt
tttttaatagtacttttaatttacatgttcaattagaagtcattttgacatctcatttgt
cttaaatttaatccataatagtatttaagctcttaaatttaacttgagagtaagtgtaga
ccgcggtgttcatacttaaagtaaaccgcatcggtttaattcacttcctaaataaacaga
cctcggctatgatgaattttcaatctttagtcggataccccttcactcttaattatgagt
gagagatccagtctgagaagccggaggttgttaaatgtacacacgtgcaccattgtccct
ttccaccccagtgacgtcctcttgtgttgacagCATCGCTGCCGGAGGTGTGATGGATGT
CAACACCGCTCTGCCTGAAGTGCTGAAGACCGCACTCATCCACGACGGTCTGGCCCGCGG
TATCCGTGAGGCCGCCAAGGCCCTCGACAAgtatgaatatttttacttttagcattctat
gacacttgtggtgtatctgtgatgataatttggctccctctactgaagtctctgaggaaa
actgccattcgttacccaatttcttactgagatacttttgggggtgattgctcatacctg
attgaggaggtttgaaggctgataatggtttgtctgtcttgcagGCGCCAGGCTCATCTT
TGCGTCCTCGCTGCAAACTGTGACGAGCCCATGTACGTCAAGCTGGTGGAGGCTCTCTGT
GCCGAGCATCAGATCAACCTCATCAAGgtgagcaagctggaaagatgttaaagggatagt
tcaccaaaaagaagaatctgttcaaaacatgtttgagtttttcttctgttaaagaaatga
catgaaatcaacctgaaatctcacagagaagtaagactagatttgaccgtggtttttacc
agatgatgtattggacatacaagaatgactcatgatttttttgctccaaggtgaaaacct
gtgttgtactgcacaagcccccctactatataaaaccttttactggactgtcctgctttt
aatgattccagatgactatgaaattaactttttagcaacgtaacaccagaaaagatttta
gaatttttaattgtgtattaacacaaatcttatgtgttaatttgtttttaattgtacact
ttatttatttactgtcatgtcagcaaccaaggctaacattccaataatacattacattct
tctctagcaatgaatgttttaggagtgaataacgtaatcatttattgaaaatcagactaa
aaaatacattgaagtattgattttatacaaataatacacttgatacgtttaacatttatc
agcaacagtagtagttactgagtttcacatcactgaatattttacaatttttattcagct
gatttttattatttatttattattattattattgttattttctttataacattacaggtt
caagttgtttattaaaaccaaccatttctgacagttctgtttttgtaataaatggaaagc
atatttcttttggctgatccaaaaaaatggtctgttctgtgacaatctataaatgtgatc
cattttatagaatatgtattctatcaagtctgtaagcatttgcaaacatctgacaaccaa
agaaagaatggcagactacaatccagcatctgcacaacattcctttctaaagtgatgttg
ccagctattaccctggcataaatgacttcagtttgtgtaaactagttttgacaacactgt
acataaaaccttttatagcaggattgaaatctgtcctagtggacaaaactggtgaataag
tcctacagaccagggttaccaaccctgtttctgaagagagagctatcttcctgcagattt
cagtttctaaacaaaacctgtcagtaattatcaagggctgctttaggttctaatgagttg
gttcaggtgtgtttgatcagggctggagctgaattctgcatgaaggtggtccaggaacag
tgttggtgacccctgcattacaattaggaatggaacaatatttatagagctagtaggtgg
gcttcttttgaattagaccacccaaatgatttttttattttttttttcctcatgttgatc
tagtttccattttattgctcattagcttctatgaaactatgtggtctaatattgccagga
aaattttgttgggacccacaaggatgactagcaactgccgtttaaatgcttgctgttaat
ctaattgtgttttgtgcagGTTGATGACAATAAGAAGCTCGGGGAATGGGTTGGTCTGTG
TAAGATCGACAGAGAGGGCAAACCCCGCAAGGTGGTGGGCTGCAGCTGTGTAGTCATCAA
Ggtgagcgtccgcctgcagtcggtttctaattgtttctaattaacttcatattcctttga
tggaaagatgatgcattgtgcagaatgagggagaagcaattagcttttcactactgactt
ggtaaaggaatatttgggcttaaggcgcagggtgtttaagccaggtcgagtccagatgct
ggctctcagtgcctcgtgtctgttttatttgattgtcttggcaagattgagtgcctgaac
acgagcctcaaggtcccacattgactcttgaggtccctagaagggcaacatttgtttttg
taaatttgcatatcgtctttatgtaaatgtattgacaggatttaaggtttctaataactg
atttaggtgtttaatgtttggtgtgttcatgtcttcatctgcagGACTACGGCAAAGAGT
CCCAGGCTAAGGACGTCATTGAAGAGTACTTCAAATCCAAGAAATAAGGCGCCAAATAAA
ATTGTTTGGAAAAGAtgctgcttttcttgtgttcttttaatacattgggttgtagttaat
tgactttaagggacattaaccccaaaaggaaaatttacctcaacccccatgcaaagtttt
caaccttaagtttcctctggtaaacatgagtttttgagagagctggttgctggcatgtct
ctacttccatggtagctggaaaaaagactatggtaatcaatctgtcccagctattcattt
tttttctaaatgatttaatgaaactcagtgaccggcgtgtgtaaaagacaatctctttac
tttggtggaaactagccttttaatctaggagtacaattttaatttacttttaaagggttt
caagtttttttttaattttttttttatagattggatactacaaaaacaatttactacatt
tgatttgctgtgctgttagtgacacctgtgttgtggaattaagtatttttaagcatttat
aaatgctcccttggtcgtttgttacataaagaataagtttctctattttgacaatgaata
cttaatgtgacaaacttaaaattgagcttacctgtcgtaaggcagttccacaagctgctc
tccacgtgtgtccaaaagtgtcagaactccgtcgcacttgtgacggcctgcataaacccc
gcccactgcgtgacacgtgaggctaattaaactaaattgcacgattttcttaaaggtgta
cgtttatcattattttggcagtacctcagttggaagattcagttttatgagtttggcttg
atataaaaacaggtggagtttgatcctatggctccagtctatgatcacaacccaatctga
caacaacaactgttagtttggttctagtggaagaagtagaaagacgtgttcatgtttatt
agtcacactgaaacgttccgtcaaatttctccatcttgtaaaacatgggtgtttaacttt
gttcctggagctctacggcagagctcagttccaaccctgatcaaacacaaccaag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1182, 2433..2549, 2744..2846, 4339..4440, 4844..4934
1169..1182, 2433..2549, 2744..2846, 4339..4440, 4844..4906
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved