Danio_rerio Locus zgc:152810
snOPY snoRNA Orthological Gene Database
Danio_rerio zgc:152810
Danio_rerio
zgc:152810
22
SNORA75, SNORA75
14382..14505, 15821..15951
19053
aacaccttagcaaccacctagcaacaccttagaaatgacctagcaactgctagcaacat
cttagtaaccacctgaaacacctgaaacaccctagcaaccacctagcaatgccttgcaat
gacacacacacacacacacacatatatatatatggcaatgctttagcaaccactcagaat
tcccaggcaacaccttagcaacggcctagcaaccaatcagagcatgctagcaaccaccta
gcaacacataagcaacgagctagatcatctatagcaaccacctaacacctccttagcaac
cactcagaacacatcaaccgactagcaacatcttagtaaccacctagaacaccctagcaa
ctgcctagaaacaccttagctaccgcctagcaaaaccttagcaaccactcagaacacata
agcaaccacctagcaacgtcttagaaaccacctggaacaccctaacaacttcctagtaat
gccttagcaacaactcagaagtcccaggcaacaccttagcaaccgcctagcaatgcctta
gcaactacttattaacaccttagcaaccactcagaacaccctaacaactggctagcaaca
ccttagcaaccaatcagaacaaccaaacaactgagttgcaatgccttgccaactgcatag
caaccactgagaacccctagcaacataccaaactatattggaaacatgctaatcttttga
taactgtttcaaacttaaaacacttcagttatttaaacttcacactttcagactcggctt
tctcaagagaccaagtttgtctacgaactttaaatttctagttcattcattcattcattc
attcattcattcattcattcatactgttcaatgagcgcaaaaaaatcagaaaaaaactgt
tcaaaagaaccgaatggagataacgagtctgaacagcagcgactcggttcacattgagct
tcgtgaacgcgcatatggtaaacgtcatgggtgtagtgggcGGGGTTTTTCAGGACGTAC
TAAAAGCGTATCGAGCGCTCTTTTCTGTCCTGTAGAGAGAAACACGTGTGACTGAACGGT
TCTTACCATCTCTCTCTTTCAGTTATCAGCTTTACTGTAAAAACAGCCCTCAGTCATGGT
AAAGCTCGCTAAGgtaagatattaccgtcaatccgttattgtcgctttaaatgcagcacg
gatctcaaaatgcgtattttcctgtttttatttttacatttggcgagaaggcccatgtgt
gtgagttatatttagtttaacatatataatattcgtcggaatgtaaggttaaatattcaa
atacttatttaaggatcagtattgacggctaaaatgagctagcgtgtgttttctgctttt
cctgtttgtgaaggtaacatggccgaccacgcttctgcatttgcaggcctcaacaaacac
gcatgatgaacatgcgtggtgaattttaagaagactcgttttgtgatgttgtaaaaacaa
attgcgttgattaataaaccctggggaggtgttaatgtgtcgtggatttagctccaaggc
atttgttcgccatgcgtggaaagtagctaaatgctaaacgcctccattttggctctctgt
agtgaatgtgggggcatttaacacgtataagaccgtgcactaaacacaattgcgttttaa
ctcgtgtttcactgtttatatgagtcaagtatgtaaatgcggcacgaaatttaatttaat
tacgttatttctacttcgctgtagggttaacgtgtgttttccacgtgttacgttcaaccc
acgtgggatgatccacgcggggagtttcgcgagcagtactttactttttgagtactttgt
tacagatccatacttaagaaatattcattaacagtcataattttattttagtttattatt
tgtataagtacattatttacattaagtcatgcacttaatagtcaaattttaaaaggttgt
accacgaatgaattatatgcaaaatctccaataacacgtgttacacctttagtgattgaa
aggtaaaaatgttggattttaggaaccaatctaaatattttaattggtgttgtgccagtc
ttgtatttatcttttttttttttttttttttttttttttgcacatttgtcttataaatgt
attaatactaaagatgaaaagttttagatgagaattcagatttttatgcgaaatcttacg
cttgtttatgcaagattgtgtttgtgttttaaacatgcacaagttacctgtgaacttaat
gaatgccaagtcttgttaaatgtacacaagtcaacatttgaggatggttaagacctttca
ttggtcaactatgtctgtcttgagacaacttgggtgtacttttttttttccccccctaga
tgtttagtttatttgaccctttcatagccctaactgcaagagctaagggggatgtgcgat
ttggagaaaatgtcttgattgcaatttttgttttgacagatttttttgatttgagtcaag
attcagctcagtctgtttcactgcatagatatgattattattatatatgttattatatat
taataatattaatttcaccatttattcaaattagttgttaaatattcagaaattgaaatc
atttttcgcttgagcaaacagtaagataaaaaaaattacctttcctttttgtgcatcagc
tcaaagtaaggagatgatgtagcttatttaaggtatctgcagaattgtaaagttttaaaa
ttaaatatatatgaattttaggccttaaagtctttaatccgctgcactattgtgttgtag
gtcttaattttaaactggtcttaattttcctctgtaaagctatacccaatcaggacagca
cccgtctaataactaacattatatttcataagtttaaaaaaaacatcatttacactattt
gcatattaatatggttttatttatctttgcaaaaacatttgtttttaatgatatggtttt
aacttggccattaaaaaatctttagtgtttagccttgtgcaagtctgaattggtcttaaa
tttgacttgctggaacttgtagacaccttgttattatacttacaataatataataattgt
gaaagtacactccgcaaattaatgagaccgataagaggcagattgaaaagttctgattgg
gcagaacgaaagtgtgctcactcaatcggctagtaagacttgacatttgctctgagtgtg
ggacattaagtacatattctacatcgtagtgcattaaatcagaataattgtcactgattt
aagtgaacatttgtataaaaattcatgtagggttttttttttcattaatatatatataat
gacatttgagatttcaagtgtgaaaagattaataatggatcatgctataaacatggtgac
attcagaattttgtattcttgtcagctttaccaattgtaagtttctaattcaatgcaata
tggtttcagctatgactgtttatgaagtatgaacgctgagcatacagatgtattaaattt
attgcacttttaaagctttatatagcctaaacaagagtagccacacctcatgatctccaa
acaaatgctgaagtgaaagcgttcgaatgcatcaagattgaatgtgtcattgattgaagc
ttaaactatatgctgtcatttctgcataatggcatctagctaatttataaagggtggaac
tcgtgtttaatacatgcacaagtgctaaaacaatctgttaaatctttcttgcaccgcagg
actgaaactgaaactgaaaccatttgaggtttctgttgactaaatgtgcaaagctttgac
tgtctagttgctaaatcaatttctaatcgcacaaatcaacatttaaattaatattttcat
tgcttgtttgttacagGCAGCTAAAAAAGATGCGCCGCCGAAGAAAAAGGCACCTCCACC
TCCTAAAGAAGTGGAAGAGGAATCCAGCGAGGAGGACAGTGATGACGATGAGGAAGAAGA
Ggtgaggaggctgacaaataatgcgctttatttttttcctgttgctattgaaaggtattt
aatgaactgtgtattcggcagGCACCACCAGTCAAAGCTGTAGCGAAGAAAAACGCGGCT
CCTGTGAAGGCAGTGAAAAACGGAAAAGCTGCTGCCAAACAGGAGAGTGAGGATGAAGAT
GACGACGATGAAGATGATGAATCTGgttagcaaagttttcagtcgtgcatttttatttta
ttttttttattcctttgagtctgaaggtcaggtgtaatttgcattgacttgtacttcaca
gAAGAGGAAGCTCCGCCTCCAAAGAAGGCCGCTAAAGCTCCAGCTAAAGCAGCAGCTCCT
GCAAAGAAAGCAGCTCCTGCTGAAGAGTCCAGTGAAGAGGATGACGACGATGATGATGgt
atgaaaactatctgcctagatgtttattagatcagcagttttaaagggatagttcacagt
tattaaatgactcatttactctccctcaagtggttcctaacctgattgacttttctgaac
actgaagatgatagccattgacttccatagtacaaaaaacaaactaagaagatcaatggt
tactggtgtacaagatgtttcaatttctttttattaggcaaagggtgtgaaattgattgc
attttttgggtggtctattaccaaggaaattaaatgcattatcaattttaatgaatttaa
ccctttaggcatgattaaaatgtattacttttatataatcttctgtatttctagATGATG
AATCCGAGGAAGAGGCTCCACCTCCCAAGAAGGCTCCTGCCAAAGCTACACCAGCTAAAG
CCACACCAGCCAAGAAAGCAGCTCCCGTGAAGAAAGCAGCTCCTGCTGAGGAGTCTGAGG
ATGACGATGATGATGgtatgtaatattctggttttaagtgaaatcaaatgcacaatgcgt
catctaaatcaatgtctttgcttccatttgcgAAGATGAATCTGAAGAGGAAGAAGCTCC
GCCTCCTAAAAAAGCTGCAGCAGCGGCTAAACCTGCAGCTAAAGCACCTGCAGCCAAAGA
GGAGTCAGATGAAGAGGAGGATGATGACGAAGAGGAGGATGgtgagtgtttgattgaaat
attttatgaaatgctgcatgctttgtggtgagtactgaaaccttctgataatgcagtggg
acaaatgttaaattattttaaggtggagcattattgatgccatcaaagtgaatgagctat
ggagaaagctttataatacagttttctactggatcccaggacatgttggactatttgtaa
atgaacaagcagacaagattaagcagaataggattagtgctcagaaaatatgtaacttat
tgaaatccagccagtattttatttatttttattaactccagacatgagattgtttacata
agatgctgtgttgctcataagatttacttgtggacatttacttttacttaaaagcagaag
aaatgtcaatgttgcaacaaagcaaacgggtaaacgtatacacttgtgggaggccctatt
tttaatgttatcagacaacaaattttgtcaggagagacttcaaatgaagtatgactccat
ttaatattgtacaatttagcaaaagtaacccttaaacttttctttctatataattctgat
gataataaaatatttattttaaatgcccttaatcgtgtgcatttgttgctgttgtctctt
tttattaaagtcgttgttattatacacaattgatttataaagggcggtcaatttgatatt
attttgctattaaatagccagagaagctgattatggcgactgtaaaacagtgggtctgat
gtttgctttgaatgcatttattaaatatttcttggtgtcttatgtttgcctcaaatctgc
tttgcattggtcttcatagATTCAGAAGAGGAGGAAATGGACACAACACCTGCGCCCAAA
GCCAAGAAAGCAGGAATGGTGAAGGCCAAGGAGGAGTCTGAGGAAGAAGATGACGACGAT
GAGGAAGATGATGATGATGAGGAGGAAGAAGgtatatatttataacggtcttgacatttc
tctggttccagggtaaaaacaaatgtaattatatgcatggtataaaggttatttgtgtat
taacttatttattaatttttattgtgcgtgcatgtgcagattacatacaagtaaatcatg
tcggtctgtgaaatgagtctagtggagagttgcgcaaaagctccagttagtcactgcagc
aatgagaccaatctcatgtgagtgcagaattaaacaaattcacaaacttgtttattaaaa
ccaattttgagggcagaataatcctaaatgcctcaatggtgcagcttcaatgctgactaa
tgtgaatggctgtaccttggctgcttcatttgctcataagattaacaaatgttgcgtttt
ctcaatgcaaagtgaatctatctgaagtactgtgtgccgatccaaacttgatgtagtaat
ttggtgtttcactttctctttacccttcaaagagctactccttgccaataatattggctt
tctttttaaactgataccattaatctgttaaatgcatcatttcgattgacggcaattcga
ttaaaagctaattgaattggcatttatctaggcaaagaagaaatggtttattgctaaatt
ctaaatgccctctttctggttgttcggaaaaatatccatgattataatttcatcgaatta
aatgagatgaaacccgtttatgttgtgtatctgtttatacctgtgtatttgatgcagtga
atgcatgctggcaaagcttaaatcggctattaataacttttatgaattaaagtttaccaa
ctttaagcatgcatcttgtgggagagtgggtggtaataagtgtctaatagctaacatttg
tacgtttactgtaaagttttatttgaggacatttaggctggtttcagcttgtagttttat
tttcgttttcattttatttaatttaatttgttaatcccgtttcatttgacctatttttat
gccacattgcttaatttgctatgggtttatttttggcatgctggtgtatgtaaagtcgtg
agtataggtttctatgatcacctggtaattttgtaagttattgctcttttgctttgagta
tgctattcgaagatcagttcaaactttcaagaagtttttaaaatgaaatcagttcactgt
ataaaaatatacaacctttttgaaatttatcagcttgcatcagttgtcggcctccaagtc
tgagttatagagattgaattttatggggcatttttgttcatgcttggtaaatgtgtgcct
caaaccccctttaaaggtcttgtgaaattaatttgaaattcttttagatgtctctgtctt
catatttgttgaaattacatcaaacattgaatagatgagcatttcaaagtccttcatgtg
acctttcagttcttaatactgcaaagtatttgtttttagggcctgaaatattgatttatt
tttctccagAAACCCCGGCCACTCCAGCTAAGAGGAAAGCCGAGACCAAAAAAGAGAAGG
GAACGCCGCCGGCTAAGAAGGCTAAAACCGATGGCGAGGgtgagacttgttttcaatact
ttaccaagttattaaaactacacatgatgatcaacaagggacttaatactgatgtatgtg
atgtcaccttattactgttctgatgcttgtttgagtgtttaaaacggggatatcttcatc
ttttgtttggagaaatgaaacatttttggtttcgtatttgcagGTTTCAGTCTTTTTTTG
GGCAACCTGAACAACAATAAAGACTTTGACGAACTGAAGTCGGCTATCTCAAAGTTCTTC
TCAAAGGAGGGCCTTGAAATTCAGGATGTGCGACTTGGTGGAACAAAgtaaggaggaaac
tgttattaaatcctatttttaggctgattcatttaaatagaagttgatttgatgtaaggc
tgcacaatagattgttttaacattgatatcacaacgtgtgcgtcagcaatattcatatca
cagggtctgcaatatgtagtcactgcatattagtattaatcagatcagtattagccttac
ggagtcagattagcatttgcatatgtttttaagacctgagagcatttcaagagagcttaa
agcattcaggggcacaaaaacaacattttgagggcattaatagcattctttgtatattta
attcagtaaataaatctgttgtttgacacattttctgtatctgaacaatgtttgactaga
actataaaatgcctacaacaaatatgaagaaaacctgtaatattcctgtttgcttgcagt
tagtttaatttagattgtttgggattttgtagagtgtgaatgatgcattataattatttc
tttccaaatagagctattcaaggcacctgaagagtttttcctatcgtgctattgcagaaa
aacaatattgcagtgttggatttatgtaaaatcatgaagcagtttttgaccatctttgtc
tttgaagGAAATTCGGCTACGTTGACTTCGCCTCAGAGGAAGAGTTGCAGAAGGCTTTAG
AGCTCAATGGCAAGAAGTTATTGGGTCAGCCAGTCAAACTGGACAAAGCCAGAAGCAAAG
AGAACTCGCAGGAAAACAAGAAAGgtaaacccgcatcttctgcttcacgtaatctcactc
tactgaactcgtgtggatgctctagatcagaagtgttcagcctggagagagcagacaatc
aagccttacttgatgagttttgccctcttcatgcttgagagcatgtagcaagaccttgat
taggatcacgcatttcagctgtggttaattagtgtaggaggtaaaccaggggtgcccaaa
cctggtcctggagggccgttgtcctacaaagtttagttctaatcccactcaagacacacc
tgggctagctgattaagctcttgacaaagatgcttgatgaaccaatcaaataataaagag
ctcagcatctttcctttgctcccgaataaagtgggttcagaagatttagatccaagacct
ttagcttctttcttgtactgtttaagtctggctatgaccttcaccatccttgccaagaca
gagaacttcacaagatgctttaactgtgactttgtttcgatattaaaatcttgcatcttt
ctagatctggggtgtccggtgtccaaatttggtctcggagggccggtgtcatgcaaaagt
taactccaacccatatcagacacacctgggctttctagaaacatccttgctggtgtgttg
aggtaaattggagctaaaatctgtaggacacgggccctccaggactgagtgtaggcactc
ctgagctaaactattcacagggttaccatgctccttgaaggtgtttgaatttcaggcata
gttaaagcattgcatgatatttctaatgcacatattaagcacaggatggacacttcatgg
agctacatatgctggggtgtgaacagggccggtgcatccatagaggcgacctagggcgac
ctcagttacatttgcgcatataggcgacagaatagagagggcggcatcagcgacaccacc
tccatcagcatccgcttgtcctcagttatatctgcgcatagggtgacaattgaggtccac
gacacccgcgcgtcctctgttatatccgcgcatgggacggcagaatagagagggcggtgt
ccgcgacccctccctcagcacccgcacgtccttcgttatatccgcgcatagggcggcaga
atagaggtccgcgacacctcacttcattttcataacgggtccctttcgttttcacattgg
ggttgagggcggcgtattcgtcctctgcctagagcggccgttcggcttgctccggccctg
ggtttgaattacaaaagggctttattttaagtccttgaatctggtgtccatcaaagagtg
ggaaccatgtaattcgcttctacaggaacagaattgaacttatcctagatggtcaagtac
tgatctggagcagtgtgaaagagcttgtagtcgctaatgtttgattgtttgttgccctca
gAGAGAGACGCCCGCACTTTATTCGTGAAGAATCTTCCATACTCAATAACACAAGACGAC
CTGAGGGAAATCTTTGACCAGGCTGTAGATATCAGAGTACCGATGGGCAACACCGGCACT
AGCAGAGGgtaagaggaaactctgacgcttctaaagtgttcaatgtcttgttttgaacca
gtttgattagaggttttgtttttccagAATCGCCTACATTGAGTTCAAGACCGAGGCCAT
TGCAGAGAAGGCTTTAGAGGAGGCGCAGGGCTCAGATGTTCAGGGACGCTCCATCATCGT
CGACTTCACAGGAGACAAGAGTCGGCAGGGCGGCAGAGgtgagaaattaaccagacctgg
agcctgtgctgggatgccagtttcagtctagtttgcaaaagttcagggtttttgggtacc
atgaagatagtccagccttaattcaacttttcgtgcattcacactaccaccatcgggagc
gccataagtcaatttcaacaggagctggcagcgaccactgccagaagctgcactttttgg
accgcatacgtgtcaaatagatgttaggaatttaggggtcacaaatggtgttttccaagt
ggcatgtattgctctgctaatgggcactaaggagtgggggagagaaaaaaattctgtccg
ctatattaaaccaggttcgtacgggtgctggaaatcctggaaaatgcttgatttttaata
tagtcttctcaaggttagaaatgcgcttggattttggaaaagtgcttgaacctgcttgaa
atttgaagttgcaaggcccgaaattgcgactgttttagttgcatatgcacccaaactctt
atctatgcaagctcaaaatatattcgggagcatttgtgcataaaattgttggtgtgcgac
aagttttcattgcaaaatgtgcatatttaggagaccattcacgcaggattttttcctaaa
aacaccaaccgcagcacttaaagtttaaaacagttgacgtatatcttattaattgcaaac
gtcatctcaatagcaacaacagtcttttcattagctgcaatattagtttaatcttagtaa
atgcaagcccttttgcgatggtgaacgctctgcagttgcacgactgacaacattgtgatg
aataaacgaaagattaaatggaacattttgtaatttatgtgtggcaaacgctgctacctg
caaactccatttttccggcttcacagtgaatggttctgacccataaggatttaatttgtt
gcacgaattttgaatggcaatgcacatgaaatattatgaacgatcggtcatgaaagattg
gttgtacacccaaacttaacctgattataagaaagagaccaaaacttaaagatatccaat
agctgaactttttaatattattattattattattattattttaccatttttgggtgataa
atttcaataaatccatgttccaaagttcaacaactaaaggtaaaatgtcttttttttttt
tttttttttttaatagcacaatggatataaatgtgaaagtacatacagcatatatcaaca
taatttaccgtggtgaagtgctagaaaagcataaaaatgcacctttaaagtgctggaata
tgaagttggaaaaggtgtaagaaccctgattaaagagtcgtatttaatcgaagtcctcaa
ctttccacttcaaaaggctctttataataaaggattttaagctgctgctgctgttacagt
cctgggaccagttgcaccagcagtctttgtgacctaaaaggacattaaaatgggtgcact
tagtgttgaattttgatggttggaaggttttacattaacgtttattatctggtgaattca
atgcaatcatatgtaatttcctgtcataaacgtgtagaaatgtagttttcatagactttt
ttttttttttttgtttttgttaaatgagatgttcagtactgaaaatcgccccatgcatgc
ccactttattggctcagcacaaaaatattcagattgaaggcaactagacagctttaacat
gtgcactagtctattattaactgctcttgcagccttgcccaggtctcagttgtgatttat
tctgaatgctaacagtgcgatctctttgttttttcctgttcagGTGCTCCGTCTGCAAGT
AAAGTGCTGGTGGTGAACAACCTGGCGTTCAGTGCGAGTGAAGACTCCCTCCAGAGTGTG
TTCGAGAAGGCCGTGTCCATCAGAATACCACAGAACAACGGCAGACCCAAAGGgtacggc
aaaattactgcaatttatgagctagcagatgcccatcaatgtattttcatgaaaccgagg
ctgccttcggggaccaaaccaagttcacttagggtatattcacagcagtctgttagttcg
ctcataaatgttacataaatctggtgcagttttgctttcaatgccttttttgagaaagta
attacctcaggtcaatgcaggacaatcaaacactgcaatgtctgttttgcataatctgta
ttggaactgggtgtgcacactgggaggttaatttctagagctttgctggtggttgcttgc
ttcacggttcttacaggtgctgcaaatccttgcattagaatctgttttcaaggtttgaat
agtgcttccagtttggaaaaagttcttggaaatttaattagttgctgtcgtataattaaa
ctaattgtaatgtgtaatgaacattaaaaatccttttgcatgaaagcaaaacgatgcata
gagaatgcagcgtcatgaaggaacaatgcaggacatgaataatatttagatgaaagatga
ccagatgtttaaagggtgaatgatagtaatgttgggcttggagcacacctttccctatac
tatatgaccattagtatttgatatgcttgatatttgagtgtgattttattaaatgattaa
atgacagcacttgtaagaaccatattactcaaactatagtgtcttttaattttaaaaggt
gcagtgtttctgcagatgtattggattgatgtcaaatcttaaatgcatcatgtattcgta
ttccgaagctgctggtccttggtcatttgtttggtgcaaatacagcaatggaatggaacc
atttcaaaagatctgcaccaaacttcagttcgtttctcccccatttgctgcaatcaatat
aatcaagatctgtttgagtcagctgaaagtgatctctgttatattttagggttgttaatt
cacttcagtaacaatcggcactcaaatattattgtattgttacaattataatttcagtgc
tgatttgtacccagtcaatactttttacaacccttgtccctttggtgttcctattatagt
tgactctaaagacattaaagtgatcttagaccattgctcacacttagacttagaaaactt
tattgatcccgcaggaaattgcttgcgtaatgactgccataacacagaaacacaaacaca
agacagaataaataaattaagtgaaataagtcacataaatccaaccaatctatagaagga
aacagccacaatacataaatacacaaactattatataagatattacacttaaaagaatca
gtggtaactaatactattaagtcatatatcaagtaatgaaaataatattgaccaaaacca
ataacattacacaaacaattgcacacaaaatatttcaagtaatagtgatacaacactcat
ttaaaaaaaacaatgatattgcactaaaaatatttaacacctaaaaaaaaaaacatacaa
atattgcagctaatagactattgcacatcttaaaacataatgcacaaacttccacacact
aaaacccagaataagtaaatatactgcacgagtagcaaagtattgcatatacaaggtatt
gcatacacggctacatcatagctctgataagatcataacctagcttactgtatatacagc
agtgaattttggcttttaaaaaaaaaagacaaggttttgagcaataaaatatttcttttt
attattgctgcacatttctgtgacactaaattgaccttttttaaaacaaacactcagact
gacaaaccagccattgctacacactttcctctccgcatccaccagacacttaaaactcag
tgtttttggaaaacattgtgcactacttggtgtgcttcatctgaataagtgtactttact
gaccccctgtggtaaactaatctaatctaaaaatgctgatcacgcttctcatgagctcct
ctccgtcagtccagtggcggtgtatggattcgcacgagaagtagagtcaaaatcacagtt
aatcaggtgttctcagtgttgcaccgatgtctgatgtgagacactttaatctgtctagga
aagatgctgcagttgaattaattgtcatataaaaatagttgcataacctaatctattata
acctaatctgatctattatttgtagattaaagtctttatagttgatggaacgtaatataa
ccagcctaaattcatttacaaaaccttaagttgtttccatccttgttttaaagttcattt
aagtgtctgtttaattaataaatgcaaatagatgacaaggatttgatgatttttcagtta
agtttcatagtatgtaggagtatctaaagcaggggtcaccaatctcggtcctggagggcc
ggtgtccctgcaagatttagctccaacttgcctcaacacacctgcctggatgtttcaaat
acacatagtaagacctcgattagcttgttcagatgtgtttgattagcgttggagctaaaa
tctgcaggacaccaaccctccaggaacaagtttggtgaccactgatctatagagtacaac
agtccaatcaaactggagcagtttgaggactcaaacctccaaccttctaaatctcttgct
cttttaatagtttgcactatggctttttgggctatagctgtgattttgtaaccgtaaatg
taacttaattttttccccctctccctttctccagATATGCGTTTGTGGAGTTTGAGAATG
TGGAGGACTCCAAGGAGGCGCTGGAGAACTGCAACAACACAGATATCGAGGGCAGGAGTA
TTAGATTAGAGTACAGCCAGAACGACAGAGAAAGAGGCGGCGGAGGAAGAGGAAACTCTG
gtatgtagatcagtgctttactgacaggtggaaagatgcagcggtgtatttacataacga
tattgaaatgtgactattgatgtaaatgttagcagctgtgtttgagatgtaataagccga
aaatgcaaatcgagaccaccatgtgtatgggtttttattttcaaacctgatatgttatat
atataatataccggataaagattttagctgtgagttttatttctagaagccagcatgact
tgcgtattgtttgtataattattattattatttttaacctaaattaaatgtatgatttta
aattatttacggatttattgtcaatgctggatgttaatggtgtctcccactgtttctagG
ACCTACGAAAACCCTGTTTGTCAAAGGCCTGTCAGACGACACCACAGATCAGACTCTGAA
AGACTCTTTTGATGGAGCCATCGCAGCCAGAATCGCCACAGACAGAGACACCGGATCATC
GAAAGGgtgaatataccgttctctgattctccacctgatcacgcttctcatgagctcctc
tccgtcagtccagtggcggtgtatggattcgcacgagaagtagagtcaaaatcacagtta
atcaggtgttctcagtgttttgggacgcaccgatgtctgatgtgagacactttaaatcga
tcaaggtgaaatggttctaaaatgattacatcatagaaggtagtatttgaatagtataga
atgtgttctatttgggattctatttttattttctgtattgtttgacaatttataagcaaa
cttttccgtttgatagagtacatgagtcactatcagaataattatttcaaacagtttaaa
tatgcatatgaggcaatttaataaaatttgcacaactcaacatttttgtttttattagtc
tatggcaacctttttgttttggcctgcctttcaatcccgaaagagggagaatgatgggga
tggtttagagattttaatttaataaaaaccttttctttgcttttgttattgttaaaagct
atctgaaatggttttattggtgtaagttaatttacatactgtcccccacaattccttggt
ttcctcactaaagtcttagcactttgactagtctatacagctttgaactccactgtgtta
taaatgtgattttgtttttattgctatgggttatcatttaaaaagctgtaatgctgtcag
tatttctcaaccacgttccaggagaaccaccagcactgcatggtttgtctcctttgtctg
ccacccccattacaagtctttcgatctctactaacgagttgatttgaatcagttaaggag
acatggaaaatatgcagagctggtggtcctccaggaacgtggttgagaaacactgtgtta
gataatacaatttgagttgatgttttctattagtaaataatattataaaataaattggga
aattgcacatggaaactttagtgtaatttagtttaatatattgaccttcagcccacggct
cgcaatatttggtttttagccctgcatatgaaaacttttgggcacctctgtacaacccct
caataaaaggtccataaattctcagttgacggatgcatgaatgttttggcctgtagtggc
ttgccttaagatccagaaatctccatttcttataaatgctgactaaatgttgtttccgtt
ctccagGTTTGGTTTTGTAGACTTCGATAACGAGCAAGACTGCAAGGCAGCTAAAGAAGC
CATGGATGACGGAGAGATCGACGGAAACAAAGTGACTCTGGACTACGCCAAGCCCAAAGG
AGAAGGTGGACGAGGAGGATTCGGCGGAGGAAGAGGAGGCTTTGGAGGACGAGGCGGCGG
AAGGGGTGGATTTGGAGGTAGAGGAGGAGGAGGACGAGGTGGCGGATTCAGGGGAGGACG
AGGAGGAAGAGGCGGCGGCGGAGGATTCAGAGGAGGAAGAGGAGGAGgtcagtgtctaat
atacacttctttggggattttgtgtgtgatatacataatggagagcagcagcctaaatta
agccaggtcttaacagtctgtcctgtttctaactgtgctagtggtttaaacgagctcttt
atttcgtttcagGAGGCCGAGGTGGATTCGGGGACAGACCACAAGGAAAGAAGATCAAGT
TTGATGATTAAAGGTTTCACTGAATGAACTGTTTTCACTGCTTAAATCCTCGTTGTCAGA
GCGTTTCTAGGACATTCCAGAAGGTCCCGGTGATGTACAGAGCCCCCCGTCCCCCTCGCC
CCTTTAACTGTGTGAGTTCTGCAGTGTCCCGCCATCCCTCAACATTAATGTGAATGTTGT
AATAATGCTCTGCTGGTTTAGGTACATGTTGTACATGCAACAGTTTCTTTTCCCATTTCT
CTTTTTTGTTACAGTGTCTATTCCTCCCTCTCTCCTCACTTTATTTCAAACCCAATTTTT
ATTTAATTTGTTTTTTTAAGTTTGCTTTAGGGTGCCAGATTAATGTGCAGTACCTTTTTA
ATGTGCAAAGCATATTGTAACGTATGCATAATTGACTCCTGTTTAGTATTTAGAGATGTA
AATCTGTATGAAAAAAGATTGAATGGGATACAGACCGAAAACAGCACGTGTTTTGTGATG
TCAAATTTATATGTAAATTAAATTTGGCTTTGACTTTAGGGTTTTTCTTTTCCTCCAGTT
CAGATTTTTTCATGATGTAAAGAACCATTTTGATTAAATATGGTTTTTAAACTActtggt
ttggtctttattttcgtaatggcagatgcataaaatcaaaataaagcctgaacaataagt
gtgtgtgtaaataagcacacaaacactgctggaatatgttagaaaagaatgtgtgcaact
tctctgcatttacatttaatggcatattgctcaaattgcatcccatcagtggcttgttta
attaagtaaaatcacaatttgtattattctgtagtgtaatttattcatgttttcctacta
aatttaaaataaaattttgctagtatatgttgctaacatgttattaaatgtgctagttca
atatttgatgatataaaacatgttcacttgttgtaaagttaagaaatcattgtcaggaca
aatacaaacattttaatcaatcgtctgtgtccatgttaaaattagaggtccctctttata
ttaagtgtccttaactactatgtacttgcatcaaaaaaaattaaatgcaatgtactttgt
gtttataatgtatttgagaacacttgtagtgcttttgagttgggatagaggttgggttat
ggcaggtttggtggcatgggtaggtttaagggtaggttaaggtgtaagggatggtcaaca
gtgtatttacaaatgtaattacatgtatttaatcaagtatacgtacacagtaaatacatg
tattaacacaaagtacattgtaacgaactatgtattcctatgtaagtacatattagttaa
ggccacttaatataaagtgggaccaaattagaaacatcacacctttaaatcaaaactact
attaacatgtaacagtccattcggagaaacataatttccaaatctggctgcaagttaatg
tgaattacaaactagcctattaattgtattttattaacctctgtccctagtcctaataat
aaaaacaacacatttatagaacatgggctgcagttctgctacagccctaattaaactgat
gcaactaatcaaggtgttgaaaactactagagac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 3916..4020, 4101..4224, 4321..4437, 4794..4934, 5012..5140, 5959..6090, 7569..7658, 7843..7966, 8587..8723, 10141..10267, 10347..10477, 12283..12412, 15154..15299, 15659..15785, 16986..17266, 17412..18053
1135..1152, 3916..4020, 4101..4224, 4321..4437, 4794..4934, 5012..5140, 5959..6090, 7569..7658, 7843..7966, 8587..8723, 10141..10267, 10347..10477, 12283..12412, 15154..15299, 15659..15785, 16986..17266, 17412..17470
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved