Danio_rerio Locus rrm2
snOPY snoRNA Orthological Gene Database
Danio_rerio rrm2
Danio_rerio
rrm2
20
SNORD94
4992..5127
8778
tgtagtttactgtatgacataatccttattcgaggctttgttttgtttcctcaacagcg
catgtggaatctgcgcttaagataaataaatgtcctatattttgttataaaaataaatca
aaaggtcaacaggctatgaagataatgtttttggtatatattttgcaacaaaatctaaac
aatgattttatcccttcctattttcaatataaagcaaagcacagaacaatgaagtgcaat
acaggcaagtaggctacctaatttgatatatttcattatagtatttatttaaatatttgt
aatgacagaacagtggtatacggatctcacattatcatacacaataataaagccatctat
tatacaaccattggctagtaattcaagtcttttgtaaagggtaaaattaacaaaataaat
aaataaataaaaaataaaaatagtgttttaatatactttctccaaaaactaccataaagg
atattggatatgccaataatcattcagtcagtttttattatagtattttaaacaggtcat
atatttaattatctttctcaataaagaaacagcattcaaacttatttttggaagaatagt
actaatgtattattattttggtctctttctttatatgtaaaaggctttttcaggccaata
atgatccggataacaataatattaggacaaaatagcataaatataaggattgaaaatctt
tattgtcattatgcaggcacaatgaaatttaattcagctcttgacataaggcatttaaga
ttttaatatgttgtttaatatatatatatatatatatgaacagtataaattattcatata
ttaaacaaagtatctaattaatgtattttaacagttagataaattaataatgttgatcat
tttgatattttagatttgtgaaatgttttgtctgtggtgatagttgtcctcctgccacta
gactgcagtatactaaaacatgcagcgattctcccccgcccgactgtgacctcttgggcg
tttttattggtgcttatcccgcgtcctgggaatgtttttgttatgaaaaacaaaggatct
atactcgttgactagttgtaaaatacgttttccgcttaatttgagttgttttttttatat
gtcgagtttaaaaataatcaacaaagtccgttggagttcgtgttaacggtttagttgtgg
tgaagaactggctaaacagctgagagattattgtggtgtaaagtttgatcggcaataaaa
tactgacacctctttgatgacagtaaatgttatattaatgatgtggtattagtgatatta
ttgatgtccaatatacgttaatcttcgtgctgaaggacaggagaaacgacaacaagacat
ttacctctgtcatacggaggatttgatgaaggtataatcacaaaagatcacacgtgcagt
ttcatgttcattattgaacgtgaatattgaagctttctaaagtattttaggttagagtat
gacttgatgttgtgtatttcgaaaacgtttactcaaatctggcgcgaaaccgcatcttcc
tgtcaggcgggttttgttgttgcaaatgggtttatgtctgccacgttataaaagaggtac
ggagaaatgtatttccccaaacaacagtcgattgtttttattatacaagatataattatc
ttaaaaacgtttattgtgcttcgtttattgtgtcatttgtatgtgatcgacagctgcagt
ctttgtgacttgaataaattcactgatagttaacgttaacttacatgctttatttacttc
taattcagtcattttgctttgaaataataacagatgcaagcacatcagtgtaaaggacat
ctacggtatataaaccgtttacttgagtgtggagttaaattatacacatttattaaagta
tatcgaacataaaaataaaaacattaagatttcacaaatgtatagttttatttcatattc
gcgcccttttaaacctgtttgtatggttttgtaatactttgcaacccccaacatgtttga
atttcccgcgaggtgcagctcttacgtgacgcggtggagaaatctgattggttcatctga
tgaacgagttaaaaggaccaaacaaagccggggagtttgctctttccccattggctgaga
ataagcgccaagaatcgaatataaaaagcgtatccggcattcatacttagtgttatcttc
gcttcagctggaccgtagacctgctagctcttagttttgcttttatttatttctagttaa
ctttgttttagaagttgtctttatttttaacctttaacttatcctcgttttgttttacca
aacactccaagctttacaatgtcgtccactcgctctcccctgaaaaccaagaatgaaaac
acaatctctactaaaatgaataacatgtcctttgtggacaaagaaaacacggtaagtttg
tttctttgactttacttttaacgaaccgcaattattgtaactactgcgtagtcatgcgac
ccgtaagttacatttttaggctctcaagagtagctctatacgcgcatataacataaaata
cgaatattactttaaatacagctactaggtagttgtgttgtaaaatgtgatttgttttgt
cctcagccacccagtttgagctccaccagaatcctggcgtccaaaacggcgcgcaaaatc
tttgatgaatcagaggtcagtccacttttacttcgtctctgcacgtgtcttcagaatgag
ctaatattatgcatgtttatctgatgtggtattaaatgtttatcgacttctggagcgatg
tctttaagttgtagataaaatttggcggattctgagcgcgctaagttgggcaggtcacat
caaactatccgggtctttttggaagaacaatggctcattaaactagtccagctgaacgga
attaaaaacgattacttaaaactagtatgatttttgtgttttatgctagttaataaaaca
atgcatgagtttggcgggcgattagcttgagctgatgtaatgttgcataaacgacgcaga
gtgtatgctaaacatgcactttaaagtgcgaatactccctttctgtacaattcgatcaat
atttagatggttttcttatatttgcacaacttgatctggtcaatcagaaaagctcttgtt
ttgccgaaaaaatatagaccggaagtagtattactgggaatgatcaatgcaccaaaagca
aacaagatggtcttattactattattatttatttgttttctggtaaacgaaggaaatcgt
gctaatattccaagttacaagaagtggaaacccaaatggtgtatataaaatgtttgatat
tttaatacagctgagtcttctcgttcatacaagcaacaactttccattatctaagacttt
ttttttttttttttttttttttgggaaatgagaaccaaagctaaccagactttaacgaac
attgtcaaatgctagcttagttagtagcttagtttttagtatatttttttatataccatt
gaataacttgctattattattttttacaaaatggtcaagaattgcaagtcttgaagaaaa
tggttaatagcccaaacagaaatgagcttattgctaaagattgtttttatcctagttaca
tgcaccataagccctaactcatgttagtttgttacatcaaacatgttttaattgcagggg
cagtcgaaagcaaagaaaggagcagtggaggaggagcctcttctgaaggagaacccccat
cgctttgtcattttcccaattcagtatcatgacatctggcagatgtacaagaaggcagag
gcctctttctggacagctgaggaggtgaactttaaaacataacaccttaacacctagaaa
tgcctccatttaatatgctgtccttactaggtgcactggtcaatctggttttgtcaaaga
tcctgaaaattagcataaatatgaatgagaaatttattagaattgatttaaattagagta
tctaattaataaatttagcaaagtttttaataaacatgtaccaaatcagcaatttaatat
tcctgcaaaagtgcaagccatttatcaaaacatgaccaaagagaagtttacgaatttaac
atgcatttattagtcaaatttacaagttattttttttcacaactagtgctctttaaatgt
acttgatataattaatcctccttgttctcaagctattaagtaacttgtccttttcagtgt
gttctaatggccctgaatataacttaaatgtcatttaaaatttgcatattgcccttggct
agtagtttaatgtaacattcagccttcatttgctagcatgctttttatagttgcaatgtt
ttgaacacttgggtttttattttttctaaggttgatctgtccaaagatctgcaacactgg
gattccctgaaagacgaggagagatatttcatctcccatgttctggctttctttgctgca
agtgatggcattgtcaatgagaacttggtaagctcataggcaaacatttacagcctggct
gtcagtcaatttctgaagggccacagtttttctttagccctcatcaaacacagctgatct
aaataatctgttcaaaagaatcttgaacccttaattggctgcatcagatgtttggttagg
gttgaaacaactgcagcgctgtggccccctccagaaattgacttatacctatgattttac
aggatttaattttttccctcccccccccttttttttaaatttatttattttgttaattgg
tccttaccacttatcttctgactctaggtggagcgtttcactcaggaggtccaggtgact
gaagcccgctgcttctatggcttccagatagcaatggaaaacatccactcagaaatgtac
agcctgttgattgacacctacattaaagattctaaagagaggtaagtgtttggacccgtt
ttgaggttattgggagcaatgatgagtggcgcaggggtacgtacctcagctgataatggg
agctgagtgttgactgctcaaaatcagtggacatgtggtcagctggttgtagggtgtcag
cacgaaattatcgccttgactgagctccctaaaaatgctcttgtaaatggtacctagtca
tttatctgactaatgaaattgttttctgtagggaatttctgttcaatgccattgagacaa
tgccatgtgtaaagaagaaggctgactgggcactcaactggattggtgataaaaatgcac
gatatggtatgttataaacatactttattaaaaagggggaaaaaaagaaaaaattataat
aaagtattaaaggaagtttattaagtgaccgctaatttaagtcttgcactggttacaggt
gagagagtggtggcctttgctgcagtggagggaatcttcttctctgggtcttttgcttct
attttctggctaaagaagaggggactcatgcctggactcaccttctccaatgagctgatc
agcagagatgaggtaacccttttgtctaccttaaccctagtatgcacctattgtagaatg
tggtactaatgtttcttattcttgcagggtcttcattgcgacttcgcctgcctcatgttt
aaacacttgatcaacaaaccatcagaagaaaccgtgaagaaaatcatcatgaatgcagtt
gaaattgagcaggtttgtgagccttcataacaagtgctttcagtcaggccagtgttcatt
ttcaggtttacacaaagggcaatgttcattaaagttcttgctgaataaagctagataggt
ttcatcagcatgactacagggcagttgtttttacagaataaactgccctgatgtatgtaa
tctggctgcttgtcacagaactgaactattagatgtagtaatttaactttattgaatgta
acaaacaaacatgactgaacacaacctgcagttccagatttgaattttctttagttgaag
agctgcatgttaacaatggattaataaacttacttttttttttttttcttctcttgcatt
tgagtgctagagtaaagtaaagccagatttcgcttgaatgataaagcttgtggtttagaa
gacagaacttttattccgctaaacacctgccataatgtactttcttgcttgacaacttaa
ctacaattgcagcctacagtaacttactcagccacaagatggtggcaaacagtctaaaaa
aggggcaagaaagaactgaaaattgactaatggtcaagatcactggtgctcaacgctgta
cctggaggtctagcttcctacaaagttcagctccaactctgaccgaacacgcatgaacct
attaattagaactaacatgcgttgcaatgtctttggcttttcagaatcaactattccaga
gtgctgtatagtattgagatgtagtgtggtcgatcatatgatagatattcccactttata
cagttttatgtgtgctttgaccacttatttattggaaaggagggcctatgtatcagtctt
ttttttttttttttttttttttttttttttttttttttgaccccttataaataagggact
aaaccaaataaaaatgaataaattctttttttttttttaataatcaagtcaaagtatttt
caattgaatgggtagacaagacctgacagggtatgtacttgcattttagtgtcttctact
tgtaattgcatcctaaagtaaaaacaatacagggcatatagttttaataatttttgtaaa
ccacaaatctgacttgtttatcttcctaggagttcctgactgatgctcttcccgtgaagc
tcattggcatgaactgtgacctgatgaagcaatacattgagtttgtggctgaccgactgt
tattggagctgggatttgacaaggtaggtttattttattagtcttgagtttgctcatggt
ggcagtgtagtccttgtaatgtctaatgatctgaggtctgtcacatgtcaaacccgtttt
gtactttcagttcaacaggtggcactaagcgtcactaaccttccaaattgcctttctagg
tctatagagtggagaatccttttgacttcatggagaacatttcgttggagggcaagacca
acttcttcgagaagcgagtgggcgagtaccagcgcatgggagtcatgtcgggaactacag
ataacacttttactctggatgctgatttttaaagactcaatctgagtgcttcaacggaca
cttaacacaaaactatggacttctgggacttttgctgtatagtttacatgtttttgttta
actttgttttagcgagattagtattaaataagcttttttatttttgttttacataataaa
aaaaaaatttgaatttcaactttttggatgaggtattgctcgaagtatcaagttaggttt
ttcaagatatggtagctcaatttagcccagactctatttcgtgtaaatgaggtaaaatga
gttatggagatttatactgcatttagtagctagcttgccccagagcagactaataaggct
aagactaatcctagtgatttatctgttagtaattcatttaagttactctggccatttact
tatattggcagtatagataatatttctcacttccatataaagtatgggatcgactcataa
attaaggtacaaatatagaaacatgaatggataaaatagatgctccaatattgggtaaga
gtatgcagttagttatttaataaactttcctgtgtaacatggttgacttttggtcacatt
taacacaaagtaaaccactgctaatttgatggttatactttggtgtaggtaactttacag
catcttcccaaaccagaacagggttcgagacattgccacactgtccatcaaatttttttt
tattttttttaaaaaaatcaataaagagaaaaatcgttaccctggctttcagaattttac
atttcataactagctttgctataagaagccaataaatagtgatgtgtatattaggaactg
ccattaaatgattcaagcttagaaaaagaactgttcaccagaaaatgaacctttacttaa
ggtttacacctgtgatcaagtggttccaaacttaagaattgctttcttgttgaacacaaa
aatatactgtggtgaatggtgaaaaagcctgctatagacaaccataggaacaaaaaacta
agtcaatggtttttaaattattatctttttccccccaccaacattcagttcaacgattgc
ttccttttgaacacaagtttgatcaaaaggagaattgtcattttactgtgagctgtcact
ttaattgaagcctaacagttaaatgcactatgatggttttctttatgctcatctgtaatg
aacatcaatgctcacatggaaacttctaaagcactcaatatatttatagtagccattatc
tagggcactcctggcatgagctgttgagcagtcgctctcttgtaagtgctctcgggacgt
tttgatactatttgttcatgggacaacatgcacatcaacttaagaaagaagtcttttgac
cttttaatacggctctacaatccacaaacttctgcttattgcatgtactcgaacacatgt
tacatctttcattgctgtacgtttctattttagagtttgggcacaactgccattgagttg
tcaattgatttgagctgctgtgaaaacagtgatggatggtcatgaaggtctgaatcttac
tgttaaagcgagagtatat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1410, 2351..2450, 2646..2714, 3717..3863, 4410..4526, 4827..4960, 5191..5285, 5398..5531, 5607..5711, 6809..6922, 7079..7778
1405..1410, 2646..2714, 3717..3863, 4410..4526, 4827..4960, 5191..5285, 5398..5531, 5607..5711, 6809..6922, 7079..7231
NC_007131.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved