Danio_rerio Locus si:ch211-152p11.8
snOPY snoRNA Orthological Gene Database
Danio_rerio si:ch211-152p11.8
Danio_rerio
si:ch211-152p11.8
19
SNORD52, SNORD52, SNORD52, SNORD52, SNORD52, SNORD52, SNORD52, SNORD52
1746..1812, 2001..2067, 2261..2327, 4377..4443, 4611..4677, 4859..4925, 5091..5157, 5779..5845
7331
ttacattttgtaacagagacccaaaaaaatacatagtattgtaaacaggcattaattga
aatttcatcatacctttctcattttatcctttttttcaatgacctctattaaatattcct
ttaataatatatatttatacaacttttttattgattaatatcctgacattgtttgagagt
ctgttccagatgttccatatttccacaccacatacagacatacacaactaataatcctgt
tcttgaacatttctaaacttttcagcttagtccctttattaatcaggggtcgccacagtg
gaatgaaccgctaatttatccagcatatgttttacccatcactggccccactctcattca
cacacatacaccacagacaaattacccgactgtgggggaaaccggagcaccaggaggaaa
ccctcacgaacatggggagaacatgcaaactccacacagatttggcaactgacccagctg
aggctcaaaccagcaaccttcttgctgtgagacgacagctccacccactgcgccaccacg
tgcctatgtttgaaaactaggttgaaaaattcaacagtaactgatttataaatatttaac
aagtacaaaccatttctgaagctattatattactaggtgtttaaaataactgttagacct
gattttttcgccgctatatacgttaacggttagcttttcgcaacttaacattacatttat
ttattttgtttttgacaataaaagaaatgcagttgccaaccagaataggttggcagtttt
ggggatttttatcatataaattattgttgtttttgatcataattaataattatttgagta
tacgttgtgtgtgttgatattgattttaaaataaattgcataaggttcaaataaaaagac
ataaactaagaataaaaatcataaaaatgacttacattcatgtaatcttgtatttacatt
caggcagatattccgctaccctgcccttctgcagcattaggacccttttaaatgttcctg
cgtgcacgctgccatgatccttcattatgcggatgtttgtgggctaggagacagtgacaa
atttgcttctttcgtattagttaaaatatctttttggttttatattatatatacacgttt
actttgaaaatgtcgatagtctgtgcgtttacctgaaagcagtatctgtaaaataactga
cgttggctgctcacggcctctccctcgtggtcgtaattttatttagttaagcatttttat
cgaatatgacttgataattttttagtaagcttttgaaaatgcttgctgcttataaatatt
gttgtgtagagaaccaaagtccaagaaacggtgcgaaagggcaaacgcagatttcttgta
agtacaagaacactttttttttttttttttttaaagaggattttagattgatgttaaaat
atatataaacatgctaaatgactggagattttttaataaaaatatatgatttaaatgttg
ttttactgcctgttatgatgaatctttagagtctctgatttaatcatgaagctcttcaca
gtgcactgaatgcatgcagttctagtcatttttgatttttgttgtggcttgaatgtacct
aaatgttcaaataacctttacaggttggatggcaggccgttgacgccaactgttgacaac
cattatgtaagtattacttttccaatgaaaaccttttttcgaagacagcattttgccctt
attgcatgtaaagatgaatcatttgactagagtctctgatttctccatgaagctcttcac
agtgcactgaacacatgcagtactgcttatgatggatttgttttggctcgaatgttccta
attgtaatttttcacaggttggatgagagaaattgaggctggtagacgatgccaacagtt
gacgaccaattggtaagaattaatttttcaaccaaaagtttcattccaagacggcaaatt
atcttttagccaattattgcatgtaatgatgaatcatttgactagagtctctgatttaac
tatgaagttcttcacagtgcactgaactcatgctgcattgcttacaatggattcagtttt
tggcttgaatattcctaaataagttacctttacaggttggatggaagaaattgaggccag
tagatgatgccaacagttgacgatcagttggtaagaattacctttccaatagaaaaaaaa
aaattcaaagaaagcacattgtcctttagccaattactgcctgtaatgatgaatcatttg
actagagtctctgatttaagaatgaagttcttcacagtgcactgaacacatgcagtactg
tttatgatggatcttgttcttggcttgaatattcctaaatgttaaaataccttctcaggg
gcctgtttcagaaaggaggttaactgaaaactcagagtattttaaccctgaaatgagaga
aactctgggttttccgtttcaaaatggcaggtttgttaaactcgagaaagcagggtaagt
caagcctgtttctgaaagaaaggtaactttaactcagagtcagttactgtggtaacttac
tctgtgaatctaacctggtcaaaagcaggttttattctctaaactcagagtttctgtctg
tctcctccccttttttaaagatgaagcggtatttctcgtcttagccttacgtttctaccc
acctattttaatgctcattttggatatgtgcataaaaatgattgatagaaacgtcaagat
gcacataactttttaaaatatgcataaaaaacgtgcataactgagtaggataaactttta
ttcgatagaaaatgtgcgcataaactacgatggaaacacttttactgaacaaattacagt
atgtacattaaaaaaaagatcatgatcatatgataatgaaaatgtgtgtaaatgaacaaa
ccagcaggctgagcacactgtaacatgtcttattgtgttagtcattctaaaatgccttaa
ctgtttcagtatttgtgtatattattaattacctccgaacgtctggtgcgtgtcaagagt
ctccgcgtctcatggcttcagacgcccccacgtgttcattgtgtttcagcattgtcttct
gacattgaggcgcaagtacattaattaggctaaataaagaattaattgacgcagcttctt
ctaccacagtaaattctgtttgatatttggtgccagtttaatcaggaagtgacgattttt
ttctctttgactcgttggatggaattttattcgcatcttttatgcaatattccagttttg
cacatacatttatgtaatatatttggatggaaacatagctattgcctacattttagtcac
acacagaagaactgtacgagaatggcttgtccttttttaataaataattaaattaaattc
accttcgacatgcactgtaactagattaatgggattattattctttctaaaaattatttt
tagtactgcttaccttctaaatgttatattaacctctatcacttgatcaataaaaaaggc
agacacacaagtgcactgttaaatcatttaaaactaataaatgtgtaaaaaagttttgaa
aaaaaaataaacgtcacaaattacattacttattttattatacttaaatatttaaatact
taaaaagtgaaattaggcattaacttgagcagctgttttcccacgctaactgtcttttct
tcactgatggttgcttcttttcaaatatatacgctcatatttgctataactttgcatgag
caaatcaagttcagctggagaaagaaatggtgatctcttttataagatattgccatagtc
actcgtaatgtctgcgctccattgataatgcctttttaaagtcatggtgtatgtgcttaa
ctctgagttggtctactcgaagttgattgacccaactcagatcagctattctgaaaccga
aaactctgagtttttaatctctcggttaatcaactcagagttcaagtttaaactctgagt
tgtttgaacctccttactgaaacaggccccaggttggatcaaagaaactgaggctggtag
tcgatgtcaacagttgacaataaaatggtaagaattgcttttccaatggaaaaaaaaaat
caattcaaagaaagcacgttgtcccagagtttctcatctatgttcctggaggaccactaa
cactgcattgtttgaatgacctctttgtctgtcacatccatcaccggtttttcagtcact
gctaataagctgatgatctgaatacgttgtgtttggttaaggaaacatgtaaaatgtgca
gggctggtggtcctccaggaaggtggttgagaaaccctgctttagccaattattgcatat
aatgatgaatcatttgactagagtctctgattttcccatgaagctcttcacagtgcactg
aacgcatgcggtactgcttatggtggatttatttttggcttaaatattcctaaatgttaa
aataccttcacaggttagatgagtgaaatcagttgccttgtagcagatgccatctttcag
caaaaaaaagaggtaattacataaaatgaaagccttttgtacattattgcatgtcatgat
gaaccatttgactagagtctctgatttacccatgaagctcttcacagtgcactgaacaca
tgctctacaaaaaaaatgagtggtttgctgtggcttaaatgaccctgaatgcttaacttt
cacagtttggatgagaaaaacagaggctgccaggtagctgatgccaacaataggcgacca
atgggtaagaatgggttttcgataaatctttcaaagatagcattttttcatttatgccat
gttatgatgaatctttagactagagtctctgatttacttatgaagctgttcacagtgcac
tgtacacatgcaatacaaaataatgagtggtttgttgttacttgaatgatcctgaatgct
taaataactttcacagtttggatcaaactgaagctgctagatagctgatgccaacaatac
acagccaataggtgagaatgagtttaagcaaaatcttttaaagaaatgccatgttatgat
gaatctttagactagagtctctgatttctccatgaagctcttcacagtgcactgaacaca
tgcagtactgcttaagactaatttgaagtggcttgaatgtttctaaaatgtaataacttt
tataggttgaatggaacaaaagcctgctggctgattctaagttgacatccaatgggtaag
aaggatcgtcaatgaaagcttcacaaattaggataaatttacacagcaattttttttata
tattttttgtagtttgcgcttctgaaaagtttcacttgtaaaagtcaacactgtcaaaaa
gatcctcattcacaattcagtgaaaaaagctgaaattgagcatttcagactggtagttgg
tttaaatgttgcacgtgaattttttttttcaagcttacactcatcgtaaccattatttcc
aataaattgatctcttgaatagaaacgtatgtgaattttcaggccccaagtcacatgtaa
atgaacaaaaatatttttattcattttcaaaagcatttgtccattaatggtcagttgcag
gtaatgagtattcataaaactagagtttctttcttttcaaggttttcaactacagggttc
gaagccaacatggatgtcttggattcatgaatctgcttaaaggttggcgttttgacctaa
ctgagctgattctctattgtgcagtgatgattccatagactagagtctctgataacaaca
tgaagatctacacatttctctgagcacagcttttttattatgagcatgtatttgttacta
agaacttttgattattggattttattttgtttttaggttgacgagatgccagtgaagggg
tgctgcatacacatgaatgcggagccgtgtaaatactggttcagtaaacctagctctttt
tcttgtgttaatgatgactgcgtttgttcggttccactgaaagtcaatgaagtaactttc
tcgcggcgcactgaaacactgacagacaatgcatgaacttttatttcatgtcttgttgtc
taatacaattttgttttctttcaaggatgtgaccgaagaggagctgtgactggtttgctg
cacaatggtgaattaaaatgatatacatcaatttaaatgcttgtttagtggcattcaata
gactgtttgagttaattttctcattttcagttttataaactgctttttcaacagagtatt
gcttttaataaacatcagaactaaagtgaaaagttgtccatgtttgttttttgcatgaaa
taaaaatattgcgtatggttttaacttttagtcaatataacattcctaggcagaaattat
ttatgcaatgtatgaactgggttattcataaaatgtatgtatttatttataatataatca
ctttgtattagcatttttgtattcacgtctatgtgaatttgattgattcaacatgtaatt
ccacccatttgttggttcgcgaaggacttttattatagaaacgtgctttcaggtttacat
ctcttattttacatgacttcacgtagcgtaaactaaagacgccgttacatattcatgtct
gcgactagcagtctattaagtgcgtacatccataaaaaaggactttatttgtccagatgt
aacgtcacaaatcttatggtgaaggtcgttttgttgcgatgacttaatgttaccgggttg
tgcacgtaagtactgcgtagcaacgcccgattagtgaatgaattgttctaacgagtcgga
tcgtttgagtgaaccagttgaagggggttacgggctttgtttggttcaacaaaagtctcc
gccatacattaaaaaaaaggtttaaagtatgaattaaagttataattgatataaattgaa
atgacaaaatgcttaaatatgagtttagttgcctttcttaaaaagtatcatttatccctg
tagttgaaaaaaaattatataaaaacgtctactaaatcctcactaaaaacgtaaaaaatc
ccagcactggccgcaagcgtaagattttattcggatgttcaagcaatgactgcctgtaag
tggcctgtgatttcaacgtaaaggaatccctattgaattggtaaactaaaccaattcatt
aaaatacgccgtttgaaagagtcgattctttgaaacgagtcagtctgcttattcctagtc
aagtaagttaaactggctcccgcacgagttaagacgacacgacggcagtttgcgtttcgt
gtttaaaagaac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1376, 1643..1685, 1877..1931, 2135..2189, 4513..4571, 4745..4803, 4996..5050, 5225..5274, 5681..5741, 5916..5967, 6145..6331
NC_007130.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved