Danio_rerio Locus rpl4
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl4
Danio_rerio
rpl4
18
SNORD16, SNORD18, SNORD16, SNORA35, SNORD18, SNORD18, SNORD18
1963..2060, 2337..2404, 2621..2718, 4323..4453, 4926..4994, 5267..5334, 5553..5622
7038
ttgctgtgagacgacagtgctaaccactgagccaccgtgtttacattaagtgatgtaaa
atgtgaaaaataatagctcataatatttacatggggaccattatatgttcacttactgct
ttctcgcagatgaagatgggctgatttttttcaccgattatgtcgtgcaaaagctgttcc
ttcttcacaagcagcactgaaacgtcatcctaaaattaaaaaccaatacatccataaata
cttttcaacaccaatttgtctattcgtttatatcacatgcgttttaccatatacgtgcag
ttgtctttactttcatcttggcataacctaaaacagacagagagaaatggtaaacagtgc
atattacatttgatgcacgtaacaaaacatggcagatctgtcgactaacattcaagttca
gtcaatggacaagtacttacttcagaaatttaacaaaagcgttggcgtccgaaactattt
tggatcccattgccttcgattgacagaattctagtagcaaattgtacttgttgaaacgcc
aagacgacagaaaactttgattacagcgcggcaaatgcacgtcaaaagcgtcacgacgca
aacgtacttgtgccactcccactttgaaagaaaaaatatctttagacattttctttcttt
attttttttgttcagtatcatttttgtgatttaactaatgaaaaactaaaaaatccaaac
atttacaaatattgtaattaattactgaaagtagttccccacccgcctgcttcctctaat
catatagtgccaacacacacacttcaaaatgtattattttaaaacacttatcttattgca
gtttataccaaataaaatagcaaatcatttaaaaaaataaccacataattatatccaggt
catctttataaaagaagcttaactgaaatgaaaacgcagacttgggcggaagtgacatat
gtcggatggatctgcaagtgccggtggagtgcttcattcttCCTTTTCTTCCGTGGCCGC
CATCGAGTTAGGAGCGTGGTTCCTGGCGAGCCGTGAAAACTTACAATAATGgtgagcaaa
atggacaattaacccaccgacttattcgcgtttttagtaaagtatcttcatttagttgtt
ttatgtgcacgtatgcataaagttgctgtgtttttggatgaattgtcacacgttagctag
taggctcgcactaccgcggctcccaggagccattttgaaccaatgctgcgtgtatacacg
tgtaggcatgattttggcagatgtatccttattatggttattaccacgaaattagagtgc
actattaatgtgtttttatttagtttagaaatttgctgtgtggccttcatcgaatccagc
atcattcagaatacactggaacattgtcggaaatatgtaggcatgttgtggcctaagtta
ggctgcgagtccagctcacacacttgaaattgtatgtgatgatgattgattaatttagaa
agacaagttgtaaattagtcatttatttggctcattaagaaagctgttataccgcaggtt
taacagccataacgtagcctcattaaaaactaaatgtaagttaacttaggcacagttggt
gaaccatcgcttcatttaacagcaggtgtctatctgctttgaaaaaacttattgaggtaa
agttggttgaatatacgttcatatgttcaatgacaacttgtgatacgatccatgtattgt
ttaccatgctactttgattattctgtcagaaatgccatgcaagtaggacttcaaaacaac
attaacactatttaattgtgaacaatgtatttttttctgttaatatgatttttttattta
gaatttgcaaaatataaaaattatattattagggacaaagtctgaatgtgtgaatgtaaa
accaaccttgcctcaatttttattcaatttaagatgttactcttgctatgatggtgtaat
ttgcgtcctactctgtgttcagtgacagttgcctgctgtctcatgctggcacagaaggtt
gatgacaacaaagtctgagcaagattccaagtttagcttaaacctttaaatgttagatat
gttgttcatatcttttaaattgtgttacagGCTTGTGCCCGACCGTTAATCTCGGTCTAC
TCCGAGAAAGGGGAGACATCTGGAAAAAATGTGGTTATGCCAGCAGTGTTCAGGGCTCCC
ATCCGCCCTGATATTGTGAACTTTGTGCACACCAACATGCGCAAGAACAAGCGCCAGCCC
TATGCTGTCAGCGAACTGGCCGgtgagtgtttttaatccacattatttgcaacatcgctc
cagtgatgatattccacttcaggtccgtgtttctgacaactgattatgctggaagttctg
agagccttggtctgtttgaaatatctgcttatggaaggtcgtgagcatgtataactttat
caaatttgttgtttcagGTCACCAGACCAGCGCTGAGTCCTGGGGCACAGGAAGAGCTGT
TGCCCGTATCCCCCGTGTGCGTGGTGGTGGTACTCATCGCTCCGGCCAGGGTGCTTTCGG
AAATgtatcctcaaataactaaatttgacttgagcaacacttgctgtgatggtgtaattt
gcgtcctactctacgcacagcgacagttgcctgctgtcttatgctggtgtggaaggttga
cgatcattgagtctgagcaggttaatgtatggatgcgtctttgaagttttcaaggcctgt
gctcacaccaacacaaaaattctattagattttttttttgagaggatatgaattgcagca
gatatagtttcaactgttactagtttgtttacagttgcattcactttaatacaaacaatt
ctgcttttttttctcttgttgcatacttgtagacaactcagtcaaatagtgtacaatttt
tttttttttttccttcccaaaaaatggcatttagatatttgtattacctgtggtgtttat
taaagaactcagtcaagcgctgattctggataagtggtttgctgaaatgcaattctattt
tgatttcaatgtgcatctcttgaaatggtagagtaccaaaaagccatacttgagtaccat
tacttgcccaaaaatgtagtgtaaaagtatctgttgtaaatattactcaaagtatgagtc
aagaatagtgagtcttacgctgagaaaggttgatgcgcttgtatgtaatttgtgtgtgtg
tgtaaacgtaacattctgtagtgtatagttattgtttaaggccatttcgatcatcataca
gtaaatattcttcctctcatcgacattccatctaaacactcactgggtcattgcgtgtaa
cgtgtctttttgaacacttaatgcttctaagcagtttgcaacatatcaagtagttcagta
tgatgcaaattattatttttttatttcttcattttattttactttctatgtgtgatttga
ttgcacaggaatcgcaggaatgatttttctaatccccataggcaggaaataataaagtag
tgactgcatggtgaagaagtaccaattctgtactaaaaatctactcaagggaaagtaaaa
gtacacatttttaaaattacttgctaaattacaattcctgaggaactgatcaataatagt
aatttgtgtttgtgtaatttattactttacaccacagatctcttacagtcacttgttcta
gttttgtgtgcacccttgctgcttgttttgataatatgctgtacataaaagctcaaatca
ttttagacttcatatttttcttagtattgtcaagttataagatgaaaatgcttaacacca
gctgtaaacagggcatgtgatagcaacagctttaaggcatttgaccaaatattgaatgtt
gtttttccatggtgtggtgaaacagattagaacagctctgagaagttgcattgataccat
gcagatatctctgataatgcatttaaagcagttcattaaatttaaaatgaataattgcac
caaacttttctgctgtatacttgtgttggtgtgaacaggcattagttgtaaaatgttaag
ccttaactccactgtagATGTGTCGTGGTGGACGCATGTTTGCTCCCACAAAGACCTGGC
GTCGTTGGCACCGCAGGGTCAATGTTAACCAGAAGCGTTATGCCATGTGCTCTGCCCTGG
CTGCTTCTGCTCTGCCATCCCTTGTCATGGCCAAAGgtgagtgagcattgtgtccagagt
ttcatgttgtcatttttttaatttgttaatctttttggggtctagtataatggcagtgcc
tgcatgcactgtgtgtaatatgtgggttgccacctaatggcattctgctcttaaatcagt
gcaagagaaacctcagtttgcagaagggccaaatcaaactattggttattccctttcgaa
ggctgagaacagacttagagaaactgccacacttaaaggtggtcttgttttttttatttt
caatcgatttgagacatgccacatttttcagGTCACCGCATTGAGGAGATTCCTGAGGTC
CCACTTGTTGTTGATGATAAAGTTGAAGGATACAAGAAGACCAAGGAAGCCGTGCTTCTG
TTGAAGAAGCTAAAGGCATGGAACGACATTAAAAAGgtgaaacatactgcctattgatta
aaaaatttattgactaaaaaactatttacagcgttaactctgtttcaatctttgtttctg
gccttcagGTTTATGCCTCTCAGCGTATGCGTGCCGGTAAGGGTAAGATGAGGAACCGAA
GGCGTATCCAGCGTAAGGGACCATGCATCATCTATAACGAAGACAACGGAGTGACACGAG
CTTTCAGAAATATCCCTGgtatgtaaagcagtcatctattttactgtgatctatatgaac
gcattttctacatgatgatctccacttctggtccgtgtttatgagtcctatgattttagt
ggaagttctgaccacacaatggaacagtgttttgttgtgctcggtggttccaatatttaa
ctgcaaagtttcttgtcagGCATCACACTGCAGTCCGTAAGCAGACTGGACCTGTTGAAA
CTCGCTCCAGGTGGTCACATTGGACGTTTCTGCATTTGGACAGAGGGTGCTTTCCGCAAA
CTGGATGACCTCTACGGCACTTGGCGCAAAGCTTCCACCCTTAAAGTGGACTACAAgtaa
gttccccaactctttaaagttctcatggtattcttgggtaaattgaacaacaatgatgag
cttacttctggtccgtgtttatgaacaccttgattttattagaagttctgagtcaacatg
gttttctggaaagccacttacacaaacatagaaatgcatcattttgtagatgaagtatga
tttagagaatttactgcaatgctatcttccagCCTGCCCATGCACAAAATGAGCATCACA
GATCTGAACAGAATCATCAAGAGTGAGGAGGTCCAGAAGGCCATTCGTCCTGCAAAgtaa
gttctggttttgactgtttatatttgcctgtcgttgcaatgatgagattcttacttcagg
tccgtgtttctgaaatagtgattgtattggaagttctgagccatctttcctttaatagtc
ctagccttcagtctatagtattactaacaagtgtctttttgaccttgcagCCGCAAGATT
AATCGCAGAGTGTTTAAGAAGAATCCTCTGAAGAACCTCAGAGTGATGATGAAGCTCAAC
CCATACGCCAAGACAGCCCGTCGCCGTGCTATCATGGCACACAACCCTGATgtgagtatc
ctcactacatcactgatgccagtgtgttgtctgagcaacatctaaatctgatctctctgc
gcagGTCAAGGCCAAGATGCTGAAACCCAAGAAGAAGAGGGTTGTGAAGAAGACCAAGGC
TAAGAAGGCTGAAGCTACTCCAGCTCAAGCTTAGAGCTCATAAACAAGACTATGGAGTGC
ACACATGATTTTCAAAATAAAACAACTGATGAAAATTAAtaaaatctgtccattttaatt
cactgcatacaatataagcattgccacgttccattggttgccatctgttaaataaatcct
atcatagtatacacatttgtataagttaaatgactgatttttcactctctttgaattaaa
ggctgcaaattcaccatactgaaagcagaacacaacattacaataaaaccacgtaagcat
ctctggggtcaaagacttcaatcataaatctttaagtttaaaaagtatatcaatcacaag
tggacatttagaagggaggtcttttgcatttgcgcggtgtaacgtctgccatttgatagc
ttttgcaattgagattttggtgtaaggaaaaaataggtatttgtcatctctcacagatgc
catcctagcataaaccaaccgatatgttgtagaacaggttttgagtgcactgtgatgtga
tgttttgttaattacagcagtgtgtttgttaatacttagacaacacctaaaataagactg
ggtggattcaggaggcagtagtttgctgttgacctctgggtggaactgaagattttgagg
gtgaagaaacaccaacagttggcttagaaaaatatggctgttttcacattcccacactgt
gagtcggagttgctggctggttcagtccaatggtgctgcacaaccatccagcgaagtcaa
cctcctcagcctctgagttcttgataaacgaatgaacctgaaaaagaattgtgttagtgt
actagctacatatttggaatatggatataatatatgagagaatagttcttaccatcagct
gcttgaggtctgctctttctgctggatttttgattaaactgataaaggaaaatcaatgaa
acaaattatgattatttttttttaataatgtgtctgtctagaattacatatctcaagtaa
cgaaatatatgtttatagttgtatttcacatgaaatatgtttgtgatcacttgggcaaga
cagttcagaaaatatacaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 2130..2301, 2477..2583, 4097..4235, 4531..4655, 4748..4877, 5059..5215, 5432..5515, 5690..5810, 5884..6038
1068..1070, 2130..2301, 2477..2583, 4097..4235, 4531..4655, 4748..4877, 5059..5215, 5432..5515, 5690..5810, 5884..5973
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved