Danio_rerio Locus rpl13a
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl13a
Danio_rerio
rpl13a
17
SNORD33, SNORD33
1617..1704, 3374..3452
4829
ttctctctctgataaagttaggtgaactgggtaaaggtgctgggaaaggaggtggtggt
ggaggtgccgtgaggcaggctggaggtgcatttggcaagaaacaggccgctgaggaggag
atgtacttcaagtgagtggttttgcttgagctgataattatgtaattgcttatacttgat
atctactggccattagctgagtattattgaaaaaataactgaatgtaaagcaacctaaac
cgttacttcatgacctattctgtcattgtatttccttcacaggagaaaagagcaagaaca
gctgtctgctctgagaagacaccaccaggaagagattgaccatcacaagaaggaaatcga
gagattacagcatgagatcacccgccacgagagcaaaatcaagaaactcaaacatgatga
ctgaggcattaagacagaaaatacaacacatgaattgtgaaactgctgaatatttgtaat
tgcttatttactaaacagtgaactctgtgattatactattataaaagcatgttataatac
agatatggttatataactgaaacaacacattgtgtattaacccagtgcattttccctctt
ttgacaataaacaagaaattgtctcgaatgtaaaagtgtgtcttggtatcaatacgtttg
gtgaaagctaactattagctaaactaactaaagctaactattggtttgagagctaaatgt
atcttaactgttactttcagtcatataaataggttatgtcatctgaccagacaattaaag
gttctgacaccaatgaatgacccaatattgtataaatatgagatatattaaaatatgccg
taatgctgggtttcaggatcagattgagaaacactgctttagaaaatgttcgagacaaca
cttctttattattatatttttaatattttaaaggcgttgtagctcattggagcccagctg
atggcagtagacataaataacaggcattacaaacgtcctctGAAGAACAGCTAATCCTAA
CGTCATTTCCGATGACGCGAAAGCTCCGCCCTCGCCCCTGTCTTTTACGCCAGGCGGCCC
CGCGTGTCTTTCTTTTCCCACATCATGGCGGACCGATTCAATAAGgtgcgttcgagtggc
acaatttacattctcatatctcgcgtttcctcgccgtgggaatgtagtatttggtggttt
ataagtagttaacgtcaactaccgccttttgcgtagtttggataatgtccaaaacgtaaa
actatgtttttgggaaagaaacgtgtgtgtgtgtgtgatcacgcatgatgtgaggctgga
cgtcgcaggcctgttagtgatcgtaacactcgtggtgctgtaaaacccggagtagcgttg
atgtccacgctcaggtactttacaaatcaactgcttctgctttaggatgaaattatagcg
tgttcagcgtttataggcctttctcaaccagcggcgcaaatgggcttacgttctgcaccg
gtgtccggtccatagcacgcattgctctgttgtgcgatatatccgaaataagtttttttt
gtatggcgttataatatgctaatattaactacttttaggttaacgtcagattagcttttt
gtcggtgacgagctcgcaaccacagttcagtattcgagtttaacgaccatgagaatactt
tacgtgcactaccatctgagacaaaaagcttaattaatattttgatattatgaactctaa
gtagcataagtatctaattaacttgggttttatttattaccagGTTCTGATCATTGATGG
CCGAGGCCATCTCCTCGGTCGTCTTTCCGCTATTGTGGCCAAGCAAGTGCTGTTGGgtga
gtttacatatttaaggtagataaagtctggtatcaaatatttataaccattctttttact
aatgaatctgcattgtttgcagGCCACAAAATTGTGGTGGTGAGGTGTGAGGGTATCAAC
ATCTCTGGAAACTTTTACCGCAACAAATgtaagtttgaccatcagcaagtgtgttgtctt
ggggtgtgttcacttgttgttttggtcctgactgaaaaagttatgcgttttagctctgtt
catgtaatattatcactttattctgattagtccccccctctgccccaaaggtctttccta
atagggtcccaaactgtcttttttttttttgcttaacatgtttgtacatgtgttgagctt
tataaagatgttataaaatttaaagatatttaaaactgcatcaagattttctgcaacatg
gaagcttgattcatagtatcaggtgttgaagcattctgccttaaagtcccattaaatcac
accatttattttagtttgctgtgtatctttcagtctaaagtttaattggaagtggactga
tttatatctgtatttttgtgagcatcagtcttcagatggccacatgctcataactattca
aatttaattggaccaaaactgctgaatgtgaacatgccctaaagcaatttgacacatgtg
atactaaattacaagttttcaaacaatgatgaactcctttatcccgaatctgagccaagt
ttgatgataccaatctacggatctgactactgagtttgagtcttagattatttgtagtca
gtaaagtcattttgattagttgaaactaaactggatgttgtgtttgtgcagTGAAGTATT
TGGCTTTCCTCCGCAAGAGAATGAACACCAACCCTTCCCGTGGACCATATCACTTCAGAG
CCCCCAGCAGAATCTTCTGGAGGACTGTAAGAGgtgagatttatctttctgttgtagaag
caagcattggctacatttcaaacagtgatgaactcctttatcccgaatctgagtccagtt
tgctgatacccatctacggatctgactactgagtttgaatgtcaatgcttgtctgttcgg
ttacatctctacaatggatgagtgtctgatgtgttttttttttcttaatcagGTATGCTT
CCACACAAAACCAAGAGGGGTCAGGCTGCTCTGGACAGGCTGAAGGTGTTTGATGGCATC
CCTCCACCTTATGACAAGgtagatttattcggtcttgcacaatttcacagattaattctg
tcaatgatgccacttttctgccttgtttgagtgtcgactgagaatacacaaaattaactg
agacatctttacttctggagtcagcaattggtctttctcgtggtttctaatctctgattg
tgttccacagAGAAAGCGCATGGTTGTCCCAGCTGCTCTCAAGATTGTGCGTCTGAAACC
CACACGCAAAgtgagtgctcaaccctccccttaatgtctcaatttaagtgtacaatatgt
tctaacgtttgctttttgtcagtgatgtttttccacagtaagtatgagtttaacgaccat
gagtccacttcatgcactaccagctgagacaaaaagccacagatttacccattttagttt
aaagtccagaaagcttgaaccaatgtagactcatttaatacttgttttagtgctgcttgt
tccccgttataaattgtatttttcctgtctttcactagTTTGCCCTGCTTGGACGATTGG
CCCATGAAGTTGGCTGGAAGTACCAGGCCATCACCGCCACACTGGAGGAGAAGAGAAAGG
AAAAGGCCAAGCTGCGCTATTCCAAGAAGAAAGTTGAGATGAAGCTGACTAAGCAGGCTG
AAAAGAACGTTGAGAGCAAGATCGCAGTATATACTGACGTTCTTAAGAAATATGGTGTTC
TTGTTTGAGCTGTCCCTGCAGCTTGTCAAAATAAATGTTTATAAAAACTAtggtcttgag
tggatggattgtgtttttgagtttagaatttaagttcatatccaatgagagggctctggt
cgcagacttggtgcagtgcaatctgagctgcatccaattattatttttttttgtaataat
gcactcacctaaccctacctattacagtgaggtcactcactccattaagtgcattgtctg
acattgcattgctgagtgatgcagtctcaacttgcgtcataaaggctgcatccacatact
attgtatccaatggcataattggtttgaacaatggttgtgttagtgactctgttctaaca
tttaaggatgttttttgtaataattaaaccaattgttcaccaaaaaaggatgtttttgtt
atctaagcagcattttctaaaactggttgaccaatggtttattggagaacttttgcattt
aatttaccatgtttataaaattgatgcttttttaattgcatcctctgtcagacaagaatt
tgttcttcagttcagctaaatagctcaagtaaatctggccctgttcattttgatggttga
ctaacatctaaattttagaacagatttgctgaatatattgcttacgagttttgtttttgt
taaggcctagtaaagtaaagctgtacgtttttttttttagaactatacgcactcgaagct
aaatctaaaatctaggcccgaagtcgccttcgtcggacttttattttgacaccagatcaa
atcgtgaattcacgtgactttcagtatcaaacatggctttcatgacacaagatcagttca
ctgctttgcaactgctgttaaaggtagtgtaatatcacatactgtttagtatatcgctga
attacttggcttgattgagctcgtgtattctgccatcttttactttgattcaggctccgt
ctaaagatgctgttcggcagatctgcacagagagtttcccagccggagccttcaagagtc
agtctgtagtggagaaaactgccaatgctc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 1783..1855, 1942..2007, 2691..2792, 2992..3077, 3250..3309, 3578..3829
1104..1124, 1783..1855, 1942..2007, 2691..2792, 2992..3077, 3250..3309, 3578..3787
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved