Danio_rerio Locus zgc:92371
snOPY snoRNA Orthological Gene Database
Danio_rerio zgc:92371
Danio_rerio
zgc:92371
14
SNORA69
1478..1611
4286
ctcctcaagtatatcaaacactgattgttactttgctgtgtatttcctcaaatggattt
ctttttttttttaaataatctttttattgtttttagcataagaaataatcaacaacataa
acagaacagaaaacaacaaaaataaataaataaataaaaataagggggggttacaaaggc
catttcaaaatatacaaatagtcagacaaaacataatacaacatcatccagaaagcataa
ggaaataaatagaattaaatatgaaacaaaaataatttacagagaaatgcataggctcca
caattcgacttactccagaccaatctcacttataaagagttacaagttagcattactgat
atagaacataattgggctccagatttttaaaatgtgtttagtttgtttgtcatcccaaat
cacatttcctccatgcgcaacacgtaacttaagcttttaacccaaatttcgaaaacagtc
aaatggatttctttaacagatatattcaagtatatcaaacattaatagcttaaaacattg
aaggcacacctgcaatcaaggcttactgtataaaaggctgaagcacgtgcttaactgact
tgcttatattgaatgtcttaggccccttattctcaacagaggataaagtaaaggattttg
gtttgttttagtgaacccatcaatatactttgtatggtaagatatgaatctaatttattc
ctgaacaacgttagaacaatactgtagctaagaaatatagccaagaaaagattctggttt
ccttatttaattagggtattaaataaaggcatgcagcacaatattcaccaaaaaaatcta
ggccaaaaatataccaactttgactgagaccacagttaaagagtatttttgtttttatac
tttgcaaaatgccagaggacatcagcatcgcgtagtgtcctgtgctgttggatccactgt
gtgtcgctgtgttgtaaagccgctccccggctcgtgactcgGATATACAGCGCCAGCATT
TCCCATGGTTCCTCCTCTTCGACTACCGCCATAGTGGTGAACGGATTGCGATCCCCGAAA
TGgtgagtgataatctcataacatcgttaaataagtagatatttcgccacacatcagtcc
atgtttgtgtattagttaaaggttttagtcgatggaactgaatatttgtcagattaatgt
ttgatggagaatgaaacggcttgcggggtgaccaacttcagccattgcagattgtgacgc
gtttctttacatgtgtgttccagGCGTCGCACAAGACCTTCAGGATCAAACGCTTCCTTG
CCAAGAAGCAGAAGCAGAACAGGCCGATCCCACAGTGGATTAGGATGAAAACTGGCAACA
AGATCAGgtacgttgagctgttgtgtagcggtgatgttagctgtagccgctgtaatgaac
accgctaccgcacgcagcttgtgttcagtggctgcatgaaagcaggacgcaattacagtg
ctaaactcttttgtgggagtactgccattatcctgctgagagcatcttctgctgtggagt
cttgattactgtcatctctatatgaccagtgaacgctctgctgtggagacataagcattg
tatatattgagaaactatgcatttaagtgagctttgctcagtctttttaaagggattaat
tgcccaaaactgacaattgtcatttactcaccctcaagtgtttctaaaccattgagttac
tgtattctgttaccacaagttattttggagaatgctggtaatctgtagcaattgactaat
gtcgtttatttaaaggttagtggttaatctttttctgccattaaaatgtctttttgtgtt
tagaagctaaaagttttggaattaaggtaataatgagaatttattttaggtttaaactgt
caaactcccttcctgaagggcttcagctctgtacagttaagttgcagccctaactaaaca
cacctgatcaaattaattgagttcttcaggcttgtttgaaacctacagatatgcttgttg
aagcagggtttgagtgaagtttgaaagctgcgccgctctagcaactgaatttgacacctg
tggtttaaaccatccatttaaatctgtagtttaccacctcaaaaacatgtcatttaccca
ccctcaaaataaaagatgaaactttgtaggtaaccaaggaatttgatggtacctaaaaaa
tcattttaaagtcaatggtgtaaattctttttttattatttatttatttatttttttgtt
aatgtataaagatttgcatcttcagcataaggtgcagaagctcgagtaaattaattggca
ttgttttaggaaactttaaatgcatgtgttggtttcctaaacaatctcgaactttggatt
cggaaagtggttgtaaaatttagttcaaactaataaacacaacagtattaataatgaaaa
taagtgtgttataagtgacttgggtttatgttctaatataataggttaaaataattcagt
ttaaatagatgtaattaaaataattaatgctacttaataaatattcataaaaatgagtgt
aaaattaaagtaggctatggcataatttaactgttccctcaagtataaattacgttcatg
caaaatgtgtacactgaaattatttaaagatgattaccaggttttactaaagttaagtgg
ttaatttatttgggctgaatttaaacaaattaggttgaacggtatttaatttaatttgtt
tgaattcaacaaattatttgcatcagttttgccaaaaccccccccccctcatttttagtc
tatgtacaccattacatgtttagaatagtgtctgcttcacagaatcctccacaaacctga
aggctctaagtgtagagattaattgaatatagcaattactagaccttactttgtttttta
atgcatgcttttcttgccaacataattcttagttccttgacaatgcggtttaccaaaaac
aagatttcagtataattgatttttaataggtgtttgtctgtgtgatgctttatcttcgct
aatctttatgcagATACAACTCCAAGAGGAGACACTGGAGAAGGACCAAGCTGGGCTTGT
AAACCACTGTTTACTTCAGCATCCCCCTCCATCTGTTCCCTGCCAGGACCACCAACTCAT
CCAGAGCTGGAGAGAAGCCATGCTATCTGGAACAGCAGTCTCTCTTTTGTACAGATATTC
TGGTTATGTCCTTGCTAAACAATAAACAATTTGTCATCGAACCAGAAttatgtggatttt
tctcttttgtgaaatggcaaatgccaaagtttacattctccattgagtggttatgcaaga
aaacaaatctgcttttatattaatacacttcatttagtatttttctgatgtttttaactt
ctggttagtgaaacaagaatcacttaataccagctgtattctgttccattattatttatc
atgtagactgctatccttctgaaatcttctctaaattgtcttcatggtttagaatttagg
tgtgaatctaagcaaacaaagcatctccagtattgcaatgtttatttaaaaagataacaa
atcatataatgcacagcactattacaaagtcaattatttgccagtctcaccaatcaaatt
gtaattaatgcaccaagtattaacccgtaagcaatacatttgaagtctcagatcttttca
atcagtcctgcactgtacaacaacctcttaaatgatctgaatctctggcgtgtgattcct
ccagagccatccacctctgctttattttcttgagcatgttcttcaactggctgtgcttga
cttgcactgttgttcacattcaagtgtcctacagtgtgttgttcatcccaggctcccaaa
agctccttcatttctctcggtgccttttccttgagatattgccatgcccttttaccattg
tagtccatgacgtctatgttggcactgaatgcaccaactaaaaccttgaccaccatgtac
tgctcatgcatggcagccacatgaagagcagtcatacctccactgcccctcaggttaacg
ttcactgacagaccctccttttcagcatgcctgagaagctgaagtagtgtctcgtcccta
ccatttttggccaaccaatgaagagctgtaaatccgctgataaagtcttttttgctcagt
aaactgggatcttcagccagaaactccagcatggtgtcataatttccatccacagcagaa
agcatccacgcgtgctccatggggtcc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 1283..1386, 3073..3286
1079..1081, 1283..1386, 3073..3121
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved