Danio_rerio Locus hspa8
snOPY snoRNA Orthological Gene Database
Danio_rerio hspa8
Danio_rerio
hspa8
10
SNORD14, SNORD14, SNORD14
2077..2172, 2505..2600, 3652..3747
6214
AAACATTTAATAAGGCATTGCGTTATGTAATGTATGTTGTGTGTGAATCTTCTAGAACA
TAGAAAATCGTAGCTAAATGAAAGTGAAACAACTTAACCAAGATCACTGTCTTTGATGGC
ACGTAGGCTAGTGTTGTGCCCATATTATTTAAAAACTGAGATATTTCAGCTTGATGCACT
TTAAATATGAGTTATAATTTATATATTTAATGTTTTTGACTAAATGTGAGCAGCTTTGCT
ACTTCCTTGTTAGCAACATATACTTTGCGCGCAGTGCCACCTTCCGGGTAAATGTGTGAT
CATTTCTAATAATTGCTATTTTCTTTTAATTCTTTTCATAGTTTTAGATATTTTCCATAA
AATAATAAATAGATGTTAAAATGTAACTCATCGTGAATGTAAAAATACTTCACTAGGGCT
CAGCGATTGGTCTCCATATCTTCAAACACCGAATCAAAAGCCATTCGTGATGACAGTGGT
TGAAAAGTGTGTTTTTACCCATTTAAATACAATATTAAAGTAAAATATATGAATATGAGC
TCTATGCGTACTGTAAATACAAACAACACCTTTTATCTCGATGTTTCTTCATGAAATGAT
GACTTGAATATTAGAGACCTTTGTGTTTCAGACCAAGGTCACCGAGCTATTGGGGCAACA
CTGTTATGAAGTTATATATGTTTTTCATGGCGTTAGCAAATACATTTTCGACAAACGTTT
ATGTTTTGCTGTATCACTGACGCTTTTCCAGTGAACGTGCAGGGTGATTTCATTCATACA
GCAGGACAAACTGTTCCGCATTGACAGCGGTTGCGGCAAACTTGAGGGGGATGGTTTGGA
TTTCTTGTGCAACCAATTATATTCTTCGTTTTTCCTTAGTAGGTGTGGTTTAATGAAGTA
TTGCATTTTTTCATTGGTTCTTGTCGGTTTAAGTCCCGATCCTTGCAATCTCATTGGCTC
CGCTACCGGCAATATAAGCTGTTCTAGAACATTCGACCGTCCTCTTATTGAAGCAAGGCG
AGGCAGTTTGTCGCCATTCCAGCTCTCCAACCGGCATCTTCATCCATCTCTGTTTTATCA
AGCTTGGTAAGTCCTTTGTTCTCTCGTTTTCGACTATGTACTGTTTACTGTAATTCATTT
CAAATCATCAATTTATTATGGAACTATTTCCAACTAATTTGATATTAGATTGGGTTTTAA
AAGCCAAGTTTTTTTTCTTTTAATTATAGAATGTTTTTTTTTCAAGATTAACCATTTGTA
ATCGTTTCCTAACTGAAGTTGTATAATGTATCCACACCGTTTATAAGTTTCCGAGTTTGT
TAACGTTATACAATATTTTTCCCTCACCTTTTCACTTTATGGAAAAATTATCTTTTTAAA
TTTTAAAACATCCGAAACATTAATGTATTTCAGTAACGTTATTTCAAACAAATTGTCTGA
GAATACTGAATTTAATTTGAAACCGAAATCGCCTCCTCGTGTAATCTCATCACGCGCCTC
AGTCGACAGTAACGTTAAGCCTTGATTAGAGACTTAAATAATTACAATACCGGCTTTATT
ACTTCATGTTATTGCGGGTATGGTGCTTCATTGTACACTGTGAAGTAGCATTTTAGTAAG
TTTTTACCTTTATGATTTTAAATTCTCCAGTTTGACCGTAGAACGTTCTAGAAGCGCACA
CCACGTGGTCTGACGCACATCCGCATATGCTCCAGGGTGTGTGTGATTTCACAATAGTAT
GTTAGCTGGCTAATAGACATCCTGGTTGTTCTGTTCATCTCAACACTGAATTCCCTTTAA
TTATTAATTGCTTTTTCCCCTCCTCTCCCACAGACACAATGTCCAAGGGACCAGCTGTTG
GTATTGATCTCGGGACCACCTACTCCTGTGTAGGTGTCTTCCAACATGGAAAAGTTGAAA
TTATCGCTAATGACCAAGGAAACAGGACCACACCAAGTTATGTAGCTTTCACAGATACTG
AGAGATTGATTGGAGATGCCGCGAAAAATCAGGTGGCCATGAACCCCACCAACACAGTCT
TTGGTATGTACTTTTTAATATTTTTCCCAAAAATTATTCGCTATGATGAAGTTTATTCCT
TGCCATTCGTAGTTTCCACCAGAGGTTGAAAAACCAAAGATGGCCCAAGTACCTTCCTTG
GATGTCTGAGCGAAACAACAATTTTGTATACGAGCCTGTCAATACAGATTTAGAAGCCCT
CTAACTTGTATATGCATGTTTGTTTTTCAATAGATGCCAAGCGTCTGATTGGCCGCAGGT
TCGATGATGGCGTTGTTCAGTCTGATATGAAGCACTGGCCTTTTAATGTCATCAATGACA
ATTCCCGTCCCAAGGTCCAGGTTGAATACAAGGGTGAATCCAAGTCCTTCTACCCTGAAG
AAATTTCCTCTATGGTCCTCACCAAGATGAAGGAAATTGCTGAGGCCTACCTGGGAAAGG
TGAGTTCATGCAGCAAACTGTGTAGTAGCTCTCTTAGCTTGTGCTTCGCTATGATGAAGT
TTATTCCTTGCCATTCGTAGTTTCCACCAGAGGTTGAAAAACCAAAGATGGTCCAAGCAC
CTTCCTTGGATGTCTGAGCGAAATGAGCTGTTCAATTGATGTTACTGCTAAGTGGTAAAA
AGGGACTAATGTTCTCTCTCTCTCATTACAGACTGTTTCCAACGCTGTGATCACTGTGCC
TGCGTACTTCAACGACTCTCAAAGACAGGCCACCAAGGATGCTGGTACCATCTCTGGCTT
GAATGTTCTGCGTATCATCAATGAACCAACTGCTGCTGCTATTGCTTATGGTTTGGACAA
AAAGGTTAGTTAAACTCATTAAAAGTATTGTTATGTATTTGATTTATACCCATTTTAGTT
TCTTTTTAATCAATTTCGCTATGATGAAGTTTATTCCTTGCCATTCGTAGTTTCCACCAG
AGGTTGTATAACCAAAGATGGCCCAAGTACCTTCCTTGGATGTCTGAGCGACGTTTTATG
CTGTCTTAAAGGAAGATTAAGCATTTAAGATGCCTAAAAGTCTTTTCCATTTTTCAGGTT
GGTGCTGAGAGAAATGTCCTGATTTTTGATCTTGGTGGTGGCACTTTTGATGTGTCCATT
CTCACCATCGAGGATGGCATCTTCGAGGTCAAATCTACTGCTGGAGACACTCACTTGGGA
GGAGAAGACTTCGACAACCGTATGGTGAACCACTTCATCACAGAGTTCAAACGCAAGCAC
AAGAAAGACATCAGCGACAACAAGAGAGCTGTTCGTCGTCTCCGCACAGCCTGTGAGAGG
GCCAAGCGTACCCTGTCCTCAAGCACTCAGGCCAGTATTGAAATCGACTCCCTCTATGAG
GGCATCGACTTCTATACTTCCATCACCAGGGCCCGCTTTGAGGAGCTCAATGCTGACCTC
TTCCGTGGCACCTTGGACCCAGTTGAGAAGGCACTTCGTGACGCCAAGATGGACAAGGCT
CAGATCCATGACATTGTCCTGGTTGGTGGCTCCACTCGCATTCCCAAAATCCAGAAGCTG
CTCCAAGACTACTTCAATGGCAAGGAGCTCAACAAGAGCATTAACCCAGATGAGGCTGTT
GCTTACGGAGCTGGTGAGTCATTCACAATTTAAATGAGTTTTTCCCCTTCTATCGCTGTG
ATGAAGTTTATTCCTTGCCATTCGTAGTTTCCACCAGAGGTTGAAAAACCAAAGATGGCC
CAAGTACCTTCCTTGGATGTCTGAGCGTGTGTTGTCATGCATCGGGAGTGTATCAAGTTC
CCCAAGGGTTCTAATTTCTTCCTCTTCTGTTTCAGCTGTCCAGGCTGCCATCCTCTCTGG
TGACAAGTCTGAGAACGTTCAGGACTTGCTTCTGCTTGATGTCACTCCTCTGTCCCTTGG
AATTGAGACCGCTGGCGGAGTCATGACTGTTCTCATCAAGCGTAACACCACCATCCCAAC
CAAACAGACTCAGACCTTCACAACTTACTCAGACAACCAGCCTGGTGTGCTCATTCAGGT
TTGTACCAAGCAGTTTGCTTTATTTTATTTCACTCGAGCATGCTTGACTCCCTTTTATTG
AAATATTTTTATTTTTCCCTCTTTCAGGTCTATGAGGGTGAACGTGCAATGACGAAGGAC
AACAACTTGCTGGGCAAATTTGAGCTCACTGGAATCCCACCTGCACCTCGTGGTGTCCCT
CAAATTGAGGTCACCTTTGACATTGATGCCAATGGCATCATGAATGTTTCAGCTGTTGAC
AAGAGCACTGGCAAGGAGAACAAAATCACTATCACTAATGATAAGGGTAAGCACGTCACT
CCCTAAATATTTAAATGAATTTACATCAGTCATTTCAGAAGTTAACTTAAGATGCATTTC
AGGTCGTCTCAGCAAGGAGGACATTGAGCGCATGGTGCAGGAAGCTGAGAAGTACAAGGC
TGAGGATGATGTGCAGCGTGACAAGGTTTCTGCCAAGAACGGTCTGGAGTCTTATGCTTT
CAACATGAAGTCCACTGTGGAAGATGAGAAGCTGAAGGGCAAGATCAGTGACGAGGACAA
ACAGAAGATTCTTGACAAGTGTAATGAAGTCATCGGCTGGCTTGACAAGAACCAGGTGAA
CTTGCTGTCATTTGAGATATTTGGACAGTCATGGCATGTAGATTTGCATTTGCTAACCTA
TTTTAGAAGTCTAAATTAACTTTTGCATTTTGTTTGAATAAATTCAGACTGCAGAGAGGG
AGGAGTTTGAGCACCAGCAGAAGGAGCTGGAGAAGGTATGCAACCCCATCATCACTAAGC
TGTACCAGAGTGCTGGAGGCATGCCTGGTGGAATGCCCGAAGGCATGCCCGGTGGATTCC
CAGGTGCTGGTGCTGCTCCAGGTGGTGGATCCTCCGGCCCAACCATCGAGGAGGTCGACT
AAGCCATTCCAAAGCCACTATGCTACCTCCATAGCAATGTTTACTGTTGCCCTCTGTTGT
TGAACTCCTCTAAAATGTATTACTACTTGTAAAGGTTTTAGAGGACCTCAACTTGCAGAG
AGATTGTTGCAATTATAAAAAGAAAAGGGGATTAAAGGATCACACTTCCAGATCACAGGG
AACAGACTTTCTACCTAGATTGCACAGTTTAAACTTGTGACGTTTCACAAGCCTTTTTTT
TTCCAACTGCCTTGATGCTTTGAAGGACAAGAATAAAATGGTGACTTATTCCCAATTATA
TTTGTTGTCTTTTTACTTTTACATCTCAATGTGTTAGATTAAACCCAAAGCAGTTACTGA
CTTCCGCTTTAAGTTATTTTAATAGAATAAAAATAAAACATGTTTTCTTTGCAGGATTTG
TCCATTGCATGTCTTTACAGTTTAATCTCAATCTACCATGTTTAGAAGCCTCGAACTATT
GTGCAGGGCATGTGGCAGTAAGCCAGCATGCATGCAGTTAAACAATTATAAACCCTATGA
AACAATTTTTAATTTATAAATCCTTCCCATGTGCCGTTTACCAGACCAAGGAAATGGTTT
ACTAAATTTTATATATATTTTTTAACTGCTTTCTCAATTTGGCTAAAGTAATCTTTAGAC
CTGAATTGTTCCAAACTTCAGAAAAGCGTAAAAGTATATTTTCACAGTTCTTGAGGCACC
CATTAATGAGATCAAATTATAAAAAAAAAAGTTTTTTTTTTTTTTTTTTCCTCCCCCCCC
AATTGTAGTGGACATCAGGTCAAAACAGTTGTACTTCAACATACCGTCATTACAAAGTAG
TGGTTCTACATCTGTGTCATGGTCATGATCTTCTGTCTTCTTGATCCTGACTTTGCCACA
ACCTCAATTTCTCCCTCTACCTCTGGTAACTGACTCATCTCTGTCTTGCTCTGAAATTGT
TAGCAGAAACTGCCCCTTACAAAACAAATGTTTTATATTCTAATTGATAGAATATTATAA
AACCATATATGGTATAGCAGTATTTAATTATGAGGAATTTTACATTTGGTGACATGCTCC
GTAAGTGAAAAAACATGGGATGTCATGTGATGTCCACTGTAATGGACAGGGTCTGAAGGG
CTTAAGTGTGTGTTTGTAGCCCCCATTACAAAAACCACTTATCCAATAACTTGTCTAAAT
AATAACCTAGTCAAGTCCTAACAACTATTAAAGTTGAATAGTGACTTAGAAAATAAGAGA
ACTATGCACTGCCACATTGACATACAGGGAGTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1085, 1833..2042, 2250..2458, 2671..2823, 3057..3612, 3815..4017, 4107..4305, 4382..4614, 4727..5214
1838..2042, 2250..2458, 2671..2823, 3057..3612, 3815..4017, 4107..4305, 4382..4614, 4727..4918
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved