Danio_rerio Locus rpl7a
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl7a
Danio_rerio
rpl7a
5
SNORD24, SNORD24, SNORD36, SNORD36
1911..1982, 2972..3043, 3586..3661, 3943..4013
5430
ataaaaacaattacacaataaaatatataggtcaggtcagtatcctcagcagtaaataa
atggagaacttttaagcaaatgtaactgtaaggaaagtaattaaatgctatttttaaaag
ttaaaagttgtattgagatggattggtggtgattgtatgggtgttaatggccagactggt
tagttatgaacaaaggaaaattaagacctgttaaaaaatatttaagacctacaacacatg
tcagtagatttcagactttttaaagcctaaaatttagcttttgagatttaagacatttta
agaccctacggacaccctgtgattgttagtttcgattcaattaaataacagaaatcatac
tataggatgacacggtagctcagtgggtagcactgtcgcctcacagcaagaagtttgctg
gttcgagtctcggttgggtcagttgacatttgtgtggagtttgcatggtctcctcatgtt
ggcgtgggtttttccttgaaaataatattcaagataccaattataaaccattgatcaaaa
tttgttctatagtaatacatcttctcacgcagttacataccgttaacgttgattcgcgat
ctacagctttacaccccgttcttatctgcatgcgtaattatattgaactgagtaattctg
ctggcaactttgaaactagaatgtatcatttgagaaacatctttcaaataaaataaaaca
caaaacaaaacattttcttctgcgtacgttaaatgtagcttgtctaggacactgaaacta
gttaaacagcaattctcgcaagcgtaattaattagctaagaactgattagatactggtgc
tcaaacttataaaaaggttactcacagctgcaggcattattttataacctttcttcaagt
aaacgcgagcctcccgcttttgttctgtcgcgtacagatgatgtcactacccaaatgtcg
cggtagttatatttcccacaatccctttcttcttcctttccGTCTGAACCAACATGgtga
gtgtttgatggttttgactgagaagccttctcttttaaaaatccttaagcatcctgactt
atagcgtgttgcagcattaatatgatatcagctatgagaaataaagacccaacacctgca
ccctgaacgagaattgtgatcttatcaagtaattagaagaagaattttgacaactcttct
gctagccgtagtgtcggcttactctcagcactagcgcctcgaaatccgacgccttcagtc
tgaaaagtaacttgtttttatacttcagtttatcatcaagttgctgtgtatattttgaag
tattctgctgttacgggtaaatcaaacatgcagtagcgcgaatgctaacttgctagcggg
atttttttttttataggccaaaatgaattagctcggccttcagctgttttataaacacgt
gagagagtcagtgtattatatggatacagaataacctgctagtttatctatgtagaaaag
tttcagagatgatattcgttttgtcaacgctcacgtttgattcttgagtaaaacagttcc
accttttcggcatcaagtagtctgccacaacttgaactactgaacacaaagaatggggtt
tagctttgcagtgatgtcttgcacctcttttgtctggcttgtagactcttgacaagtttt
gtaatctgctgaacttactgctcactgtggacaatgaagtgctttcaagtaatactttgc
atctctccacagCCCAAGGGAAAAAAGGGTAAGGGGAAGAAGGTGGCACCAGCCCCTTCA
GTGGCCAAGAAACATGAGGTCAAGAAAGTTGTGAACCCCCTGTTTGAGAAGAGGCCCAAG
AACTTTGGCATTGgtgagtccttgcagttgtctgaagtgtagctgtctgagtgcagatga
tgtaatgaatatttgctatcttaacagcaatgcagacaatctcccaccaagatcgctgat
gcacatgttgagtttgaaaacctgttagctgatcctaatacagtttgaaaatgaaaatct
tgcattttaatgtccagGTCAGGACATCCAGCCGAAGCGGGATCTGACCCGATTCGTGAA
ATGGCCACGTTATGTCCGGCTGCAGCGTCAGCGAGCAATCCTGTACAAGCGACTGAAGGT
CCCCCCTGCGATCAACCAGTTCACCCAGGCTCTGGACCGCCAGACCGgtgagtctgattg
tgtacttaagctggatatttttactgacaaaaaaaaaaaactcctgtaagaggtgattca
cccaaaaataaattatattttacgcaatcttcatttgaaacctgcatttttcttgttaac
caagatggtatgttgtgatgctagtaactggcacctatttacttccatttaattttattt
cttattacttaaactgtagttgtattaatgtggaaaataaataaccacagttattttaaa
tcagaatttttactaacatatggaaaatgtatattgagtgttaaaataatgaatttagca
ttatggggcttgtttaaaatgtaattgcataaatattcttgaccaggttttttagtataa
acattgcatgttggcactgggtcttctgtggcatatggtattaatagacagtcttgccaa
gtaaattgacttgttgggggaaataatgtaaagccatattaaacactgatgcataaaaca
ttttttcacgatgaccaacagaaggaaatgcttaaactgacactaatgctttaatgtaat
agcactttatgcaaagatgtgaagagtagagtagtagggaacaatccattgttagatttc
attagattttatttttttataatcgataaccaattttgtgtaggaactattggtgcatgt
taactggtataaatgtagtttaaattgtcagtattgagtggcctcctaaatggcgtttta
tatttatttatttatttttacacttattgatgtgcagatgatgtgaagaatatttgctat
ctgagtagtaaatgcggacagtttccaccaagatcactgatgcacttttttttttgtgag
atctctactttaaaatcaacttaaattgtattgtgagcttgttttcttggaggtccttct
ggcatttatgctggatttataattgcggaaatgctaatggattttattttatttattttt
taacactttgaattattttttctgtagCTACCCAGCTGTTCAAGCTGGCTCACAAGTACA
GGCCTGAGACCAAGCATGAGAAGAAACAGAGACTGTTGGCTCGTGCTGAGCAGAAGGCTG
CTGGAAAGGGAGATACACCCACTAAAAGACCACCAGTCCTGCGCGCAGgtggcttttttt
ttttaattaatttttattttatttattttttaaagattgtttaaacaatataaagttgta
agattttaaaattttcatttcttttctttctcagGTGTGAACACTGTGACCACGCTTGTG
GAGAGCAAGAAAGCACAACTGGTCGTTATTGCTCATGATGTGGATCCCATTGAGgtgagg
atctcaatttctaccaaataaagttctgttttaaagtagtggttgtctgcaatgatgtct
tgaatttcttcacctgaattcaaactgaagatcaaaatacgagctttttaaccctgagca
acaaccactcctgcatctcagtagctttttgtttctggtttgtaattttataatagggct
gaaatcggggaatgttaattttttttatttccttcttttatagCTGGTGGTGTTCTTGCC
TGCTCTGTGCCGTAAAATGGGTGTCCCATACTGCATCGTCAAGGGCAAGGCCAGACTGGG
CAGACTGGTGCACAGAAAAACCTGCACCTCCATCGCCTTCACACAGACCAATCCgtgagt
aaaacacaaacactcagttaactttcctttgctgcacatcctacagctatgatgtctgaa
tttcttcacctgaacaaccatgtggtttaaatgagctttttaaccctgagctaaatggtt
tgcatctaatcatacatttggtggtttttgaataagtttttgttggttaatttaattttt
ttccccatcttcagCGAAGACAAAGCAGCTCTTGCTAAACTGGTGGAGGCCATCAAGACC
AACTACAATGACAGATATGAGGAGgtcagtttattactcgatttaataactggatctggt
gcaacacagaccatcaatttttctattgtactttttccttgaataacatgactgctatct
gctaattttattttaatgctctcttcagATCCGTCGTCACTGGGGAGGAAATGTCCTGGG
TCCCAAGTCAACTGCTCGTATTGCTAAACTCGAGAAGGCAAAGGCCAAGGAGCTGGCCAC
TAAACTGGGTTGAGCTGTCTTGTTTAATAAATATAAAAAATGTTCACAAAAgcgtcaggc
gtctgattggttcttttttgtttagtttaaacaccattttcttctttaataatgatttgg
agacgtacaggtaaaaattccaaaacatgaaaccatatgaaaattagctattgcgttcaa
caccactttcttagtgttcattattcatcaaacccctcattgagttaaatattaagcagc
aatttatttttattcaattgtaatgttattttaactcttaacggatattgattttgtact
atgccatacaatcatggggcatgtattctaattaatgctattgcattgctgtgatttaag
attctaattactttaaaaaatgtcattgaatttaaatttagctagattgccttaatttta
cacgagcattgctgtaattgtcagaaaaagaatacacttttaccaacagtgttaagttta
acataaaatagtttttattttacagcattcaaaaagggcaaaatcctgaatatttttcat
aaagcaatacgcttgatgaattttgcataccacatgtaggaagtagcagcacacagtcca
tacctgggagaaaaacaaaaacagtatgttatctttaggattaaagcaattttttgagag
caagggtatatataaataaaatagacttaataagaagtaacattttctataagaaaatgg
gttagattgagtttaacaaaccatgtgatgacgtattgcaggtgttcattcctcaaggtc
actcttgtctgccctcctattggcccaccaggtactgtgctatctaaataaaaaataata
ataaaaaaagatttttaatattttaaaacatttgatgtgatcactggtaaaacaagttta
gagtttgttctaaatattcttgaaaagtcaggatattgggaaaagcacttaaccaagcac
agcatcaatgaagatctcttcggcaccagtgaccttagccatggcctccaggtcacgata
gtgccatctgtttgcctccacattgttttca
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1752..1872, 2057..2206, 3207..3347, 3454..3533, 3763..3893, 4094..4163, 4288..4430
1013..1015, 1752..1872, 2057..2206, 3207..3347, 3454..3533, 3763..3893, 4094..4163, 4288..4392
NC_007116.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved