Danio_rerio Locus rps11
snOPY snoRNA Orthological Gene Database
Danio_rerio rps11
Danio_rerio
rps11
3
SNORD35, SNORD35, SNORD35, SNORD35
1544..1628, 1929..2015, 2202..2286, 2587..2671
4391
agaacaatattattttaaagcatcattattttctcaaaaatgtcacacacacacacaca
cacacacacacacacacacacacacacacacacacacacacacaattcatatattatatt
gggtcctctgaattattagccccctgtttatttttctcccaatttctgtttaatttataa
cacatttctaaacacaatatttttaataactcatttctaacaactgatttaatttatctt
tgccatgatgaccgtaaataatattttactagatattattcaagacacttttatacagct
taaagtgacatttaaaggctcaactaggttaattaggttaaataggcaggtttgggtaat
taggctagttattgtataacgatggtttgttctgtaaactattgaacaatacatagctta
aaggggctaataattttgaccataaaattgtttttgaaaaatgtaaaactgcctttattc
tagccgatataaaacaaaaaataaaaattcaaagggggttaataattctaatttcaaata
tatgtatttatatataaattatataaaaattgtgctggtttacttcaaaaagtaacagga
cattataaactttaaaaaaatgaattatattattttataggtcagcctattccaatcccg
tgttactgtattgttatagattaaactacactggtagaattagttaacagttgccgataa
ttactcaccgctttgatttattaactgttagatcatacttacgctatttgtctttctttt
cgttctcccatctgtgtatattcatattataagttatatttattatttctgtcagcatcc
accgcatttaaatgaaacgttatgtcaaagagcttagcttagaatctatgatatgaaaac
gattttaaagttattttattgtaaaggatataagccccgcctacgctttgtcgtcatatc
cgtgaaagactgtcttccgtctgcctcgcgcatgtgtagtcCTCTTTACGACTCGGCTGG
CGAAGATGGCGGACACTCAGgtatgtgactccgaacggcgtggtcgcaaaaaagcgtttg
aattaccgtcaaagttaaatctaaagccgcacgttatggtggattagcgtgaaataaacg
tgcatggaggcagtcatggccaaaacggactgtattcggcattataatatgctatttctg
ttccggctagcgtgtaggaagtgttgctgtacgggaacacgagcggccttcctttactac
accagcagaacgtggcttcataaacacttcagagttacaagcagatactctagcagtgtg
taaatcagcatgggtggttgattcactctttgtaagtgataaaccaatagagaccgtagt
ttagtcgctccttaccaaaatgagcaatgaaaatgttctctaataacggtgattgtaaaa
caaatgcttttattttgtaacgtcattaacccaaaacgcatttctagattgttttcttaa
ggattacgtgtgcatttaatacacctactaaatacacacgaagctgcaaatgatgttttt
tctcacgatggtcttccaagtctgtcaggctctgacgacactgccttatggcatcactga
tgcagcaaaagtcctaaaactgttaaactaatgactggaaacgctcgacgttgagtcatc
ttaagaagatgacagaagaggcttttatttttattacacaaggattgtgactgactctgt
gcttgtgcttaatttcagAACGAGAGGGCTTATCAGAAACAGCCCACCATCTTCCAGAAC
AAAAAGCGGGTTCTGGCAGTTGAAGGAAGTGGCAAAGAAAAGCTCCCTCGTTATCACAGA
AACGTTGGATTGGGCTTCAAAACCCCCAGAGAAgtgagtttgtgtttgtattcatgattg
taactttgttgcagatgatgtctttctcacgatggtcttcctaaactcttaaagagctct
gaggaaactgcctaatggcaatgctgatgcagtggagtataaatttagtttaatccagtt
aagttcagtggactaatgttcttgtgctttattttcacagGCTATTGATGGCACTTATAT
TGATAAGAAATGCCCCTTCACTGGAAATGTGTCCATCAGAGGCCGGATTCTCTCCGgtga
gtcttcatattccttggcagtttaattgtagtgttgttggggtgcaggtgatgtcttttc
tcacgatggtcttctgaaccctttgggttttgaggatgatgccttatggctttactgatg
cttccctgtcatttttggaaatcaaagcttaaaactacatctcgattacaatacactaag
tttctgatgttttttttttcctcagGTGTGGTGACCAAGATGAAGATGCAGAGGACCATC
GTCATCAGACGGGACTACTTGCATTACATCCGCAAGTACAACCGTTTTGAGAAGAGACAT
AAGAACATGTCTGTCCACCTCTCCCCATGCTTCAGgtaaaattcctgctgtggcactttc
atttatttggttaaattaaaatctagacacactgagttttaagatgtcatctgaatttgt
agctagctgcaaatgatgttttttctcacgatggtcttccaagtctttcaggctctgacg
acattgccttatggcatcactgatgcagcagatagtttatcataagttttgttataattg
gtttaagatgtgttgatggttaatgctttaatttttcactttgtttattaccagtattat
taatgttctctatttgtttagGGATGTGACCGTAGGTGACATCGTTACAGTTGGAGAATG
CCGACCTCTTAGCAAGACTGTGAGGTTCAACGTCCTGAAGGTCACCAAGGCAGCTGGAGC
CAAGAAGCAGTTCCAGAAGTTCTAGAACTGATGTTTTTACAATATGGCTCCTCTGTGTTG
TTGAAAAATTAAATAAAAAATTTAAAAAGAACATTGgttgattgtttatactacagtctt
taatgcctttgtgcacaagcatcttttagaaaaatgaccctcaatgtgatttttttttgg
atgtcctttatccgttttaaattctcagaattgtgcttgcttgtatagtaacactttaca
gcctcaatgttagtaaatgcagttgagatgtaatagacttttttgtcttgattgacggca
gaaagaggtttgtcttattttttgatgtaaatacaaaatgttttcccttttcaactaaat
attgagagattatttagttatgtcttcagctattgctaaaattaacaaatcccaagtaca
taatgtttcacaattcattcttgttgtcccaatgcaaatcaattcatccctaaaatttaa
gtggattcaacaaatgttcagCAAAAAAAAAAaaactcaattgttttttaacttgtttaa
aaagcagctaacagtgtcttacagtttggctatgatttaatgttaatgtaatcgactatt
tggggagttacatttccttcattagtcaattatggcattgactgttttttagttacttaa
gctggtttcacttggttcccaagccaacacgtcttgataaaatatacattactgacgtta
aatttttattttttctaaaaatctttttgggtttagctactgcttggtatatcactgcaa
ctgggagatagttttaagtctggcagcattcaggcttgttcatatgatctgcactaacgg
caattacaacagttagctgtaatttgtccaaacctgcaagtggaaacacgacctcagtag
atggtactaaaataacatctgcaggtaaatgaaggaatcaaatggaccaccaacacttat
cgctaaataaaaaggaaaacattgcttaacattggaacaaacggttttattacgcactaa
aaactgggacattattaacaaaacattaacaaaccctaaaattattagtacatattttca
acagtcgttaggtcggccgtggcctagtatgaactgaatgaaatagaagacttgtttagt
gaaaagcaccgtattttagtcgccaataatttaggagacatggacactttttttctcttc
tccagcagatggagccacttcacctgtgctctacgcgtcaacaatacacgtcactcgcct
acgtcactcacgtcgtacgtgtttgaacgtggcggcgcgaagaaaactggagatttatac
tttacatcggtgcttttctctttatacacatctaacaagatcaacaccttaaacagtaaa
ttgtttaagttagtaatttacgcttgtcgcgatactgatgtgctcgtattattaacagag
cagacatgacagccacggtaagctacaaacaattagcatgtttaacttaagtaaactatt
taccgtataact
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1758..1892, 2080..2155, 2365..2494, 2781..2970
1025..1039, 1758..1892, 2080..2155, 2365..2494, 2781..2904
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved