Danio_rerio Locus rpl3
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl3
Danio_rerio
rpl3
3
snoU83B, SNORA54
3617..3714, 4809..4945
6128
atagagattgaatgtgcctgaagaaatatttattatgcctgagactgtgcttgctgaat
gtttataataattattacatgaaaatcagtagaagtaaaaaaaaaagttgttgttagaga
gagagagagagagcacctaaaaattaattcagtcatcaattactcaccctttacatgttt
caaacctttgagttatttgcttctattaaacccaaacgaagaaattttttcaatgaaatt
taaaggccagtaactattgacttctataatattttcaggcatacaatcggtctaaaaaaa
taatttttaatacctgaggctgtgcttgttgaaagttctaagtcaaagccagctttattg
tcaattcagccatatgtacaggacatataaagaatcgaaattacgttactcagaagtttc
tgatacatataacaaaaatcagtagaagtaaataaaagttgtaattaaatggatagttca
tcccaaaaaaatttaattcagttatcaattactccccctttaccggtttcaaatgttttg
tgagttattcgcttcttttgaacacaaaagatattttgaacagagttggaaacctgtaac
cattgaatcacatggtatttgattttactaccatggatgtcagttttacaggtttttcag
tgttcttggaattatcttgtttcgtgttcaacagaataaataaactcctaaaaaagtgat
atcatgtggttgagtaaatagttttaagtgagcaatccctttaactccccttcatgtgtt
actgattctgcttgcaaactgttttagatagtcacgtacaccgtccgataatgatagtaa
taaacatcaagattaaaataatttaaaaactattgagattttttacacactttcaacata
cttcagccacgtgtggagtccaattcattactactctcccatagagggcgacgccgccac
tggaggatcataacgtctgtgcgaaagacacaagttgtgacGCATACACGTCGAACGTGC
TTCCAGCTTTATAAGGAAGCGCCGCATTCCTTTCGCCCTCTTTTAATCGGACAGGAGACG
AAATGgtgagtgtgcggcttttacttacaacccgatcaaaatcaaacgcatcgtactttt
tacagatacatcccagtttgtgttgtatttattaaagccagataagcgttttattatgtt
tattgcaggttgtaagagggttttacgcatggcgcacgggttttcggctgtatgaggaaa
tggcaacattcttgtctaaattaggcttaaaaacaagtatacacgactgaaggttttgtt
aatctcaaaactgaaatctaagattgttacttaaataataaagaattttttttgtaagtg
tttgttatggccacggtctccacacgttgtgcggcagccggcgagtcaggcctcggtttt
attagccagaagttaaagtaaccgtgtcttttatatatgtatttttgtatttaacgttct
catggtaattttaaagtcatatatgcgatacagttttgtgtacaatggttttttttttct
gagtgaagttgtgaattgcaataacggtaaataaggttttttaagttaaggaatgttttg
agttttaacgttagttcaatttgttaaatatatatttgcagtaaaatctcaaaataaact
taacagaaattaactctattgaaaccttacaagaatttatgctttccaaatcgacaaacc
acagagttacagggtcagaaaatgttaaatttgtgagtttttaaatgttatttaaatgag
gaaattaaacgtgttataggcgattaaaaaacgttacaacatactttgtagaaattctgc
taattgcacaacccaaaataatgctaaaggatgggtctgcgcactatagaagaaacaatt
aattttagttgacttaatgcattcatgaggataaagctatgcagttatggagatgacacc
attatggatgtgaagaatgtgaaattggcacttttgctttattttggtaaaacaaatata
aatattttaaaacattaacaaatattgagttttttttcttttactacgtactgtaaaata
catgcttgcaaaaacttttttacatgttttttttttttttttttttttggcaaggttaac
atttgcatgcatctcattcactcctttgtgaagcattataatttatttacatttccctct
tttagTCTCACCGTAAATTTTCGGCCCCACGCCACGGCTCTCTGGGTTTCCTGCCCCGCA
AGAGGTGCAAACGCCATCGTGGCAAGGTGAAGAGTTTCCCCAAAGATGATCCCAGCAAGC
CTGTTCACCTGACTGCTTTCCTTGGCTACAAGGCTGGCATGACCCACATAGTCCGTGAGG
TCGACAGACCTGGCTCAAgtgagtgaccccttcagttcttgcatgctgaaattttatgtc
tgccattgatgatactctcgacgggcggacatatttgggccatgagcccttgctgaatgt
cgagtactgagagcagttgcataactttaaaaatatctttgatcagtctggttgtataaa
actttttttttattgcagaatttaaagttttgtttttttaaacccattcagAGGTCAACA
AAAAGGAGGTGGTGGAGGCAGTGACCGTTGTGGAGACTCCTCCCATGATTGTGGTGGGTG
TTGTTGGATACGTCATGACCCCTCGTGGTCTGCGCTCATTCAAGACCATCTTTGCTGAGC
ACATCAGTGATGAGTGCAAGCGTCGCTTCTACAAGAACTGgtaagttaaacaacttctgg
tcgcagtgcatgcatatttagtctggagctggtggtagctggccagattaaacaatgttg
tttttttctgagccagtctaatttgtcggtatggtgcagctccgctcaggtgcctcgtgc
cctgatgagctccgggctccgctggccggtggaaagggctccttagaaaccgtgccatga
gccaaaatgacctagtgctgtcgatgcctcccctttttttatgaggatgggcaagcagcc
gtgcccagtctccttccactggcccactgggctatgaaggaactgcgtgccaacctcttg
ttctcccctgccctcatctaccaccttcagGTATAAGTCCAAGAAGAAGGCCTTTACCAA
GTACTGCAAGAGGTGGCAAGATGAAGAGGGCAAGAAGCAGCTGGAGAAAGACTTTTCCTC
CATGAAGAAGTACTGCCAGATCATTCGCATCATTGCCCACACTCAGgtgagcttaaactg
ctcattttaactccgtaattgtttaaaatgatttaatttttaaatttaatccattgcatg
attttccttttttcctcagATGCGCCTGCTGCCCCACAGACAGAAGAAGTCTCACTTGAT
GGAGATCCAGCTGAACGGAGGCACCATCTCCGATAAGGTTGACTGGGCCAGAGAGAAGCT
TGAGCAGTCCATTCCCATCGCTAATGTCTTCTCTCAGGATGAGATGATTGACGTTATTGG
TGTTACCAAGGGACATGGATGCAAGGgtaggtggactgctttctcttttcccgcttttga
agtgtttactttagcgtcgtgcatgtaatgatgaaaaacatggattaaccgcgtcaggca
tggcgcccgaaacgcatgaggaaatttcccatgctgccttccttctgacagcacacttgc
ccttttttagaagcaaatgcaaacttgaatacttttctgatcaaagatgtgtttctgtag
GTGTGACTAGCCGTTGGCACACAAAGAAGCTGCCCCGCAAGACCCATCGTGGTCTGCGTA
AGGTGGCTTGTATTGGAGCCTGGCATCCTGCCCGTGTGGCTTTCTCTGTGGCTCGTGCTG
GACAGAAGGGCTACCACCACCGCACAGAAATCAACAAAAAGgtaatgcttcagaaagtca
ctcaaatgttcatggcatacgtttgtggacgttttgttgcagtcttgcctcatgcatgct
tttgttcacctttagATCTACAAGATTGGTGTGGGCTATCATAACAAGGACGGAAAACTT
GTCAAGAACAACGCCTCTACTGATTATGATCTGTCCAACAAGAGCATCAACCCTCTGgtg
agtgtgctgttgtctccctattgtgaatttgataaattgtttatatgcatgcattaatac
tgatgcctttttattttagGGTGGCTTTGTGCATTATGGTGAGGTGACGAATGACTTCCT
CATGCTGAAAGGCTGTGTGGTCGGAACCAAGAAGAGGGTTTTGACTCTGCGCAAATCTCT
ACTGGTCCAGACCAGCCGTCGTGCTCAGGAGAAGATCGACCTGAAGTTCATCGACACCAC
CTCCAAGTTTGGTCATGGACGTTTCCAGACCATCGAAGAGAAGAAGAACTTCATGgtgag
tggatgagtgcttaggtcacaggacatgtgcagagaagccattgtgtctcttatcgcaaa
cagacaaaccctgaacgtattggttaattaaaccgagttcagtgagtgcatagctgctgc
ttggagtaatgtctgaagtttaaattggtagcattaagcctccggtcgcgtagaggttat
gggcctcttgtgtgacgctgcatttacttggttatttgcagctggtccaaagtgatgact
ttagcttaaggttctcaacagatctgctgactcaatagcttcatcactctgctcagttgg
cattgagcttgtaattgcttattgtggcgcgactaaagaatgcggaacacattggtcctg
tgcaggtcagtgcactgttcgtaacctgtttcagcctaccagtctgagatttgggttcca
ttccagtgcaagattaataaactcagtgaggcaggggagtggtgcctcatttgtgctttc
tccctgttcactctctgatgacattcctcttctggttttattagttaaatgagtgagtta
gatctcttggtgaccagttttctcctttttctctgacagGGACCCCTCAAGAAAGACCGC
CTGGCCAAGGAAGAGATGGCCTAATTGTGTTCTGCTCCTGTTTTGCCTGGTTTCATGCAG
TACTGCGGAGTTTAATAAAAACAAACCAAgttcatgacttgtatttttttaattgttttt
tttttttttaaatcctaaatccagagcagcttttaaagggggaaaaggggggtgggttat
ctcctgaggaggggcacctcagccaatgagggcagtggctctagccacccccctatgcac
ggccctgcatggcagcgtccatcttgctttatagatcacgattacttgtttgtgaattgg
aatatcatgtagttgatgacatgaacaagcgtgtaaatgttaaattaaaatggaaaaaaa
ataagggagacatttgtcatacattgctgttgtggctgtgtagtgtcatgtgacaaacat
gcgtcgccatggaaacattaaggtgaatgttctttaaaaaaaaaaaaaaaactgacttcc
gggccagatagaatcttttaaactcaccggtaaaaataactaaattatctacagattaat
cgatcattaaaataatcgttagatgaagccctactcaacaccaactttgcgggcagagat
tatgtgggtcctcaaagaccaatggtttgtggtcatgtttgacgagtcttaagatgacaa
agcagttggaccttcatgtccccccctaggtggatgaccatactgttgtgcatgtattaa
accttaacttttagtttaaaatttgttttatttaattcaagtagcccacttgtacagtta
ttttttttttttaagggtttaaaatgtaaacagatttgacatttttcccctcatctgttg
gaatgggtacgaagttggcattgaatttaatttgaaatagtattaaagtttttaatagcc
ttgaacttagtttggaggatcctgggagtaccctgattaagttgtcaggcgagttatatt
ttgatgggtcaagtgaattttccaaaagatattcgggaaaagaatccttggcatatagcc
ttgtacaagtctaatggttaagtcgtaatgtcttaaatttaacttaaagaaacctgcaga
aaccctgct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 2225..2417, 2631..2799, 3150..3285, 3379..3565, 3780..3940, 4035..4136, 4219..4434, 5019..5128
1082..1084, 2225..2417, 2631..2799, 3150..3285, 3379..3565, 3780..3940, 4035..4136, 4219..4434, 5019..5063
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved