Danio_rerio Locus rpl7
snOPY snoRNA Orthological Gene Database
Danio_rerio rpl7
Danio_rerio
rpl7
2
SNORD12
2119..2208
6862
agactaaaatgtgaccaaacggattaaaacacacacttacataaacaacaacaaagaca
attttgaaagacattcaaaacaatttaataagacatatgtgaaaaaacaaaagtagcaca
aaacaaacaaacaaacaaacacatttaacgttaacttagacccaagattctagggtccgt
ggctttaaggttaagaccccattatattgtttttactgcactaaattccaacatcaacaa
caaatacactgttagtttacgcgtaaacttaccggtggagggcttcaattgtcggtagat
ttctcgcgccatctctgcagtttcttcgttactctgtcggttgatgtcccacagcacaag
ggtcgctcgtctgcgggcaaactcgagcgcaaacagccgcccgagaccgcttccagctcc
ggtaataacgcacacttggccctccacactcttctcccgtggacgaataaaccatttagc
accggccagtacgaacgaccagattattttaaaagtgaccacgaacaactcggtggcgat
attcatggtgtttcaactcgacaaactaaacaaactaaatcgacaagaaatgaaactaga
taagaaatcaaaccgcaaacgtgataaaagaaacaccctgtttaaccaaaatctgcaccc
ctcagcatccacgaaatctgcccaaaacaatgtgtttttgaggagctccagctctttaaa
tatgctccaactcactgggcttcacaactttccacgcgtgtgtccgcctgttatgcaaag
taaccaaaacttctgcgtcaaatgcgtgtacacctttacgaggctgagcgcatatttaca
ggatttatattaattattaaatattgacgtgagcagaaaaatgcttaatagcaaaataac
tagaatataatgttttaaaatgcaggcatatacttgaagacctcgtattttaccggaagt
aagaaggacctgccttataagaccttaccgcgcatgcgtagAAGCCTCTTTTACTGTAGG
GATAATGGCGGGTGAAACgtaagttgataaccgtgcggtgaaatcttcttccatccgttt
agttattgctctttttatagttataagaaacaaaatgagcatcgcatatatgcttaacgc
ttaagatgtgaaaattgccaagtatgcggtgtgattaatcaatacatttcgcatgattgt
ccgtgtagcccatcggctgattcggtcagcaacgtgtgaagcaacagtttatgaaattac
attaaaatatgtccagatcagcagttctgtaggagaaaaatgccaaagtgtggcgcgttg
ttacaaaatactctagtatatccaatatttatcaactgtcattagctagctgctaacttg
aaggcatgatgctaccgcgctagcatattttaataaatatatgcttaagtctaatgttcg
gctgattaactgtgccgtgtagattaagcaaaccatatttatgctgtttggtctttggca
aggttgtgttaaatactggttttctgacactatacataatggtcgtgcaggttacagtca
gtatctgacttgtatgctgtttaaatattagtgtggtgtagtttatatatttacttattt
ttgttacaactgtgacgatatccctgtctgtatgtcaaaggtgcttactaggaaatgaca
tgtgctgttattcttatttagGAAGAAGAAGATTCCCTCAGTCCCAGAAAGCCTCTTGAA
GAGGCGACAGCGGTTCGCTGCCATCAGGGCCGTACGTCTGAAGAAAGCGAAGGCTGACAA
GAAGgttggtggtttagtgttatccattttatttattcttttaatttataaacgaaggct
cattttttcaaaagtattaatgtggccaaatctgctctgtcccttagGCCAGCAAAGTCA
CCAGGAAGCTCATCTTCAAGAGAGCTGAAGCTTACCACAAGGAGTACAAGCAGCTGTACA
GGCGTGAAATCCGCATGAGCAGGATGGCTCGTAAGGCTGGAAACTATTACGTCCCGGCTG
AGCCCAAACTGGCTTTTGTCATCAGGATCAGAGGgtaaacttttgactttccagtgttgg
ttctgttaatccgtcacagattgtggttaatgatgttgctcttttttccccgtcttatcg
actatgctgattcctcttgaaaataagccaaatcctctgaaaccaccacgaatatcaatt
tgaataaactcaaactgtcttttggaagttgcttgattgggatgctttgtctgtcctcag
TATCAATGGTGTCAGCCCTAAAGTGCGCAAGGTGCTTCAGCTGCTTCGTCTCCGCCAGAT
CTTCAACGGTGTCTTTGTCAAACTGAACAAGGCCTCCATCAACATGCTCCGAATTGCAGA
GCCCTACATTGCCTGGGGgtacgtaaagctgatatttaggttaatgtttcaattgtgatt
gtcattgctttattttctgccgtcttatggtttactaccattattcaagattaggaaaga
tcaattgaaaaaataaacattcagtacacaaattaggatattttagacagcttcattttg
ccagcacaacaatggatgagacagaaaaggaaccgaaaacattctatgtcacttaagtgg
tacaactataagcatataaagctccaagaagacttgtttgtgtatgtccttatcagtctt
ggcaggtgtcggtttgcatcctgttgctcataataaacgcacacattgatgagagagaaa
acattcacaaataaactagtttaaattgttttggttatgtttttcgtgtaattacagttg
aaccactggagtcagattggatgtttttcgtgtaattacagttgaaccactggagtcaga
ttggatgttttgagtgtttttagtttgtttttgaactttaaatgtctcaagactttgcag
tttatagaggttttaaattttatataaagataaaagatttagagatctaagtttttaatt
gggatcagtagatgaagatcttgggtgtttggattgatatgattggtgaattattaacag
tattatgattttgggttattttttgcaagaatgcaataaattgtaaccataaagacttag
aaaagtttatgtaacatttttaagtgaaaaatttcaacaaaatattatcctatttagtgg
cacaaaaaaaaatccaaacattttacaattcaatgtatttttctaaaaagccttttcatg
ggacaccaatctacatattcattttgtgggagtctcatggataattttaagcacttgtaa
cccacacaaacatgagtatcttaacccctgaaccagcatttccctaacaaaagttgtccc
acttgcactgggtttttccggtgcaggtgacagggcagacaagcagtttaaaccaacaga
gaactgaagctttggacctgttgacagccatgcgttcagcaaaaatggtttaattagtta
ttaaaactaatctgcaaaattaaatagtgaatttattagttttcttgttattttagtcct
caaattatgatttgtaattagggctgcatgattctggataaaatgagaatgacaatttgt
tttgcttaatcaagatcttgattttctcacgattctgtaggtgtaaaataacaataatag
cctactcatattaacctttatttcttgtaaaacaaaatctaataataataggcctatgca
taggtctattgttggttaaaatgctaaattttgtatagacttgagacggtgtacttgaac
agaccataaatttgtccacagtctagtgatgacatcaaaatatagctatttatagttcta
aagttgaattgtgtttgaaacaaatgcttgcaatatgttatacttgtactttttatccta
tgtactttttaactggtaaaatcagacatttgttattatcagtttccttgttggattata
ttcaatcctgtataggttacagaagttgtactgacactgttaaatgtttattctcatcca
cagcactgtttgctttaaaggaaaaaccatatcatttgcttgtagtaatctttactctaa
aatgtgatctgatcatttaaatgtgtgcacttccagttcgcagtgtgcggctcatggctg
ctttaactgtgagagaaaaaaacataaatgcaaatcataatttgtacccagatggttccc
gattaaagagcaaaaccttcaaaacaataagcaaaatgatatttacacctttatcacctt
taattcacagcctatgccggttctgttcactaaaataaaactaatttgctgctgtgtgca
tcctctccttggtaaacaaacagtgcattagctcgtgtgatgtcacggcagcatatacgt
cattacatgaagacagaaattacatttttgggtgaattataccttttataaatacagcat
gctgactcttaacagcttttggagtctgtcaatgttcatgagagtgtgtgtgtatatata
tatatatatatatatacacacacatacataaaacaaagaccacctttatgcttctctcct
gactttgaaaatataattggctgaattgtagaaattgagattgcgatcttttagtggtta
atcgtgcagccctgcttgccatttttatatacattaattgcattataacagctggtagct
ctcctgtaatcacatcacaggccacaggttaaaaagcactgcaatgtgatttgagggatt
gagtaaattttttggtgacggtttcttaaagtagttaacagtagtcttgagtagcttaat
aacatgttaaaatgtttttttcctcttatttttcatagCTACCCCAACCTTAAATCAGTG
CGGGAGCTCATCTACAAGCGTGGATTTGGCAAGATCAAGAAGCAGCGCATTGCTCTGACA
GACAACTCTCTCATTGAGAAGACCCTCGgtaaggacaagctacctgaacactagctgtgg
cttcagcagcatttatacgggttcactctgatggttttcatctctccagGTCAGTGTGGA
ATCATCTGCATTGAGGATCTCATCCATGAGATCTACACTGTTGGGAAGAACTTCAAGGCT
GCCAATAACTTCCTTTGGCCATTCAAATTGTCCTCTCCTCGTGGTGGCATGAACAAGAAG
ACCACTCACTTTGTGGAGGGAGGCGATGCAGGAAACAGGGAGGACCAGATCAACAGACTC
GTCAGGAGGATGAACTAGGAACACGTGgtgagcaccagacagcagtagatgctttgttct
tcagtagtttgacagttgttcatttacttttgtagaccaggtgataagagcgaagtgttc
tagtgtaagaagtgctggtaatttgcatattgtgtgctgtactgcctgttcatttctatt
aattgatctcagaaacatgacctttagggagtacttctatagttttattactggccaacc
acagtagaatttactggaggatttaaagcagtggtcaccaaacttgttcctggagggctg
gtgtcctgcagattttagctccaaccctaatcaaaaacacctgaataggctaatcaaggt
cttacaaggtatacttgaaacatccaggcaggtgtgtttaggcaagatggagctaaaccc
tgtagggacaccggccctccaggaccaggattggtgacccctgatttaaagcatcaccca
acaagctgttggaaatgaatcagatttaaaacaaatgttagggctgttgaatctgctttt
ctgctaagaacttctattgataccccctctttctttttttcttcagGTTTTTGGAACATT
CTCTGCTGTTGGTCTGTGAAGAAAATAAAATCATTTACACACAcactggttttgagattt
atttcttggcatctgtttattgtgacacttcagtttctactgatatgcactgtgaagcat
gagtctctgaagtcaaaacgcatcaaagatgctacatattgccacatctaaagaagcaac
ttgctataaaaccagtttgagatgagaatgatgccttaaagaacatgcccatagtttctt
gtataaacatttatttgtttaatggtggttctatgtttctggaacaatgcagtcactatt
tcaaagaaaagatgtacagctataaacaatgtcacattgatatacaaactaggatccgaa
cttaatgaaaaacaaatttgatatatgcagaaataagtctgtaatttctgaatgtagata
caatagtcaagttgttttgatgaaatctgctcaacgcttgtgcaagaagatgatcgtgca
gtgcttatttcagggttgtttcctcaccttttgatttgactgacagacaatggttttcac
atatttcaacattagggttttcaagattatattaaaaaacctgagaacataattatattt
gcatatttgtctctataaaaagtaggactttctgtacagacttgtctgaaccaaaccaaa
gatcttaacgccttctcataaatgactgtttatgaaaaggcaccgatttgaatacttaaa
gcaggatttgtattcctgcctagtttgttttaaaaaccacttaagtacaattgacatcac
acaacctgtgtttctacactaaattgatgtagcggataatgtcttgaatgtacaattaat
atacaaatcatacagtcactcaagcttctccactttgttgacgtccatttgacctccctg
ttgcctgggcaaaccgtattgcacatcaggagaggaacataacaaaaaaaacattcttaa
aatgtacaatattcccatccagtcaagctgacatctcatagaaataaagtgccatttcct
tcatccagcagagggcatagttg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1701..1803, 1907..2073, 2280..2417, 4838..4947, 5029..5246, 5806..5862
1024..1037, 1701..1803, 1907..2073, 2280..2417, 4838..4947, 5029..5237
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved