Danio_rerio Locus rps8
snOPY snoRNA Orthological Gene Database
Danio_rerio rps8
Danio_rerio
rps8
2
SNORD46, SNORA47
2119..2224, 4238..4370
5118
aaacttatttttgtgtataaaaaatttacagtgtaacacaaaaaaaattacaataagat
caagagcatgatcatcatccgagaaatacagaaatatatcttttatagacaaatttaaat
catgtttaaatagggatgataaataaaaaataatgtcattccaaagatgtttaatgtgag
tgcaaatatagaataagtgaaataaagtcttttcatgtatattgcagaaagtacacaaat
tagatatatcaaaataattagcaatttgggaatttgtaggataaacattatgcaagatcc
taaaatgtatttctcttattttgttggatatgctgaatttttcaggtaataaccatgctc
tcttccattgaatgcagtcagagaagttggtccaaaaaaatttacatcttggggtggtac
atagagtaatgtaacaatcgtctgacatgtctgttgtcacattttttatcaaaaaaagac
actccatccaaaaaaagtttaggcataattgtttccctctcattaaagtaaagaaaagtc
tttaataaatgcacataactttgtgacaaactctttataacacagttgaaggatttagct
ggcaaagggaagttatacaatgtcctaaattcttcatattccaaaatattgccatcattt
ttaaataagtccaaaacaaaaactattcctctttcaaaccacttatcaataaaaagagat
ttcccacgagttaagacaatagtttgataacaagcaggaaatgttcatgggccaatgaca
tcaccacattgaagtggtttactgttttatatatatatttacatatatatatacacacta
tagtaactaaatgaatgactgtttctgcaaaacactggaagggctcgttgtggcagtccc
atgtacttccactgactgaactgctctcgcgagtcgcgacttcagcaggtattctcgcga
tatgtgtttgcttgaaacccgcccatgagcctctgcgagccCTCTTTCTAGCCGGCGCCT
GAGAATGGgtatgtgtcttccgattctgatcgctggaacaatccgtcttcatcttctcta
tccgacgaggtttatagttaatctgactttattttgtattacagaagtaatatttaaaag
atttaggtgaaaatcgcatgatatagtgtattttaaaacagtttgcgtaaataaactgta
aagtggctggatacgttgctcaagatggctgcgcgcatgcgagagtacactttcacagcg
tgtagagaacagacgaagctgtagttacagggacgagtacaaggcaagctgtaaatataa
aagtactgtgtatgtaagtaacattgctgtaaaaaaatattgtgttttagaggtgtagtg
tatgggaagtagttagcacagctaactaagctaaacgagtgagatgcatgtcaacttacg
acgctgcatggccagctaacgtgacccgagaactggatttatgtagtttgtaaacgttaa
attaacattcactttatatttcttgtcataaatgcgattgcaacactatctgttcgctaa
tggtggaagcgtgtaatggcaagagttcacgtcgtgttagcttgttgctaacgttaaatg
aatcagtttgctgatttgtaagtctttgcttttaaagtaacgattcgtccaaactcaatc
ttaagtttaaaatgcagtttttttctctctttgaagttcgaaaatagtatttttttaaat
gttttttttcttttagagtcatcggcttgacacgatgagtagagttatttttgtgggttg
ataataaagcttgagtgtacatgatgaatccaaattgcggaatccgattttccatgcgga
taaacaccttggagaactgaacgctcaagcatttattgagtttacgttctactggcattc
atatttgtttactaagtctaacgcatttcaatctctttacaccacagGTATCTCAAGGGA
TAACTGGCACAAACGCCGCAGGACCGGTGGCAAACGCAAGCCCGTCCACAAGAAAAGGAA
GTATGAGCTCGGGCGTCCTGCAGCAAACACCAAGgtgaaacactcttcagtgtacttttc
catcagtatgggaaatgataatgtgggtgatgttaacatgtccttaggttggtcttattt
ggccgtcttggtcaaagtctttgaccttccaatgttaggattcgtcatagttacactgac
acatggctgaacccacatggtctcttcatacgtctttgttgtatgtctaaaggtatgttt
tggctcctctctttagATTGGACCTCGCCGCATCCACACAATAAGAGTCCGTGGTGGAAA
CAAGAAATACCGTGCCTTGAGGCTCGATGTGGGAAACTTCTCATGGGGGTCAGAATgtaa
gtttgtatttgttagtgctggcaatttacgtgtagtgggtttctgcaggttttaacaatt
actcaaagttaagttaggattttttttacattttcattggaaattactttggattcatac
ttgaagtatttggtttttgaaagtgacattatagaaactgtaaaggcatcagagaactct
tatattgaggaaagttatgtaaattcaccattaggttgtatttactagatgtctgattga
tttatttattgatttatgtttgtaaaacattttcagtaagtcgtaaattaagttactcat
tcttaagttacctatactacatagaattatgtatttggacaatttggaaaagtttgttct
cggatattatacaaaatatcatgatgtgtagtgtttactttgtttaaaaaaaacagattt
ataatattgggacaatgcagatgttctacaatctgttttaaatctaaatgtaaaaatatc
ctttacaattgtgcaaaaagtgtttagcaatgtatatttttaatcaaataaaggtttatt
tgtaaatgacaacttaaagttgtcttcatagatccttaatattgtaattcttttggtata
aaataaatcacttttgactcatgcaatctgataaatgacaccagtgacaattggtttggt
ttccttctaataatttttttctgtactttttataaagtctaaaatgtgctttcaaaaacc
tgcagaagccttgtctgtagttctttcggtgaagataatctgaccagttctgctactgaa
tgttcatgatggatatctatgttccaactctgagaaagaattttaaaaattgacattttt
ctaactttgattgccttcagggtgttttaaatatattgttacactttcagGCTGTACCCG
CAAGACCAGGATCATTGATGTGGTCTACAATGCTTCAAACAATGAGCTGGTGAGAACCAA
GACCCTGGTGAAGAACTGTGTTGTTCTGGTGGACAGCACTCCTTACAGACAGTGGTATGA
GTCTCACTATGCCCTCCCACTTGGCAGGAAGAAGGGAGCCAAACTGgtgagtgcaaacga
gtgtataggtttgttttatagtctttctgtgacgataactttgtccagttctgctactga
aatataagtgatgcagtttaagactctgaggaaggcttgtaaatcatgttagtcctaaaa
tatacactgtcagtttctaattgttgcattttaatttgtcaatccagACCCCTGAGGAAG
AGGAAATCCTGAACAAGAAGAGGTCCAAAAAGGTCCAAAAGAAGTTTACTTTGCGCAGAA
AAACAGCCAAGATCAGTCCTCTGCTGGAGGAGCAGTTCCTGCAGGGCAAGCTTCTGGgta
aggctagttatgaggtctgaacgtggctttttaatgtgttcatgatgaaacctttaacca
gttctgctactgaaaaaatggtgctgagcttttaacctttctgacatgcactgaaaagct
gcctgcagtctcgcttggcttcagtgcaaattttaaaagtctgtgtttgtttttccccca
gCCTGCATTTCATCCAGACCAGGACAGTGCGGCAGGGCTGATGGCTACGTCCTTGAGGGC
AAAGAACTGGAGTTCTACCTGAGGAAGATTAAAGCCAAGAAAGGCAAATAGATGTACAGC
GCTCTTTGATACGACCATTAAAGAAAACACCCCAACTCAtgtcattgtcttcattttata
cagtggaaagtttattttattggaaagttggtttggccaagagaaagctgtgttttacac
tttatgtaaaacaactcgttgagctacattgttataaaaggaggattgagaaagttaggc
agctgttttagtactgcattaactggttataacctcctagaaaaaaacacaagtgctcaa
agtgctctttcattctgtgtgtaaaagtagtcgagttcttgtggacatgttctgaaaatg
gtaagagatttgtaattgtatcagggcttgaaaaagaattttaattcaaatatattttct
agctcttttacttagttttatgaatttacgtaaactgcaattgagtcaaatatttcacag
aattttttttttctttgcattgcaagtcttaaatgtcaatgaactaagtgctgttcattg
ttggatgaataagtggatagtcaagcaagtacacttctagtgacagcaaaggtgttccca
gaggcctttactccattgtgaagtaaatttacaaattttatttctcatcaatgaacgttc
tgtttgataatattttatacatgtaacatttttaatttatcgttattgataattgtaaag
ttactgtaaaaactgaaatccttcatttaaaatgtttttactgatcccaaacatttaaaa
tcttgtttctggagatctttctgcttgtgtagttaagctgcatccttgattaaactcttc
tgtccttaattgccatatgccctagatcagttgttctcaaacgtttttcatcaagtacca
cctcagaaaacaattgtctctccaagtaccaccaaaatgagcagtattgaaatacagtag
cgcagtaggcccagtaaagcagctacaactctgcacagttaaaaaaacatggcagattac
atcagaaatataggctatatgtcatatatgacatattatatacatcatttttgaaaaatt
ttgaaatgtgtgtaacgtt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 1967..2073, 2296..2395, 3290..3465, 3647..3776, 3961..4118
1024..1027, 1967..2073, 2296..2395, 3290..3465, 3647..3776, 3961..4070
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved