Danio_rerio Locus gas5
snOPY snoRNA Orthological Gene Database
Danio_rerio gas5
Danio_rerio
gas5
8
SNORD74, SNORD75, SNORD75, SNORD79, SNORD79, SNORD77, SNORD77, SNORD47, SNORD47
1373..1453, 1601..1674, 1864..1934, 2465..2547, 2735..2816, 3074..3154, 3288..3368, 4163..4234, 4422..4492
5653
aaagggcatgtgcactgcacaggttgagccctatgtgtgcacgtgcctgatggagagaa
tttagccacaacaccagagtcacacccctactcgttaggagaagtgccatgggattttta
atgacctcagagagtcagaacctctgtttacaatctcatccgaaagatggcactcactgt
cagcatagtgtccccttcactatactggggcattaggaccacagattgagcacctcctgc
tgccctcactaacaccacttccaactacaacccagttttctaatgtggtctcccattcag
gtactgaccaggctcagccctgctagattcagagtgagtaaccgatcttgggctacaggg
tgactataagtgaactatacagggtcacctgaactggactgactgaattatattcatatc
tattaaaaataaacaacgaaatgtaaaagctctaatactgctgaaacttgaaacactgaa
ttgtttataggaaacaataggcttatttgttctggacaaacataagggacgaaaatcact
ctcagtgaacaacatcactataagcattttaatcatttctaaataaaagtattggcttga
aattactcttcgtaaacgcatagattagtaaagtgcatatatatatatatatatatatat
cattatttgttaattaaaaaggttatatgaaaaggaattgatcatagagatttttatttt
catcagaattcattaaatggctccccaatgtcctcatttaactggtattactaataagag
ttgtgtgtacctaactaatgtattaaccactgctacacctactacagtaatagaactgtt
gaaacgaataagtattaacattgcttttaccgtttatctgcattcaagtaacatgtcagt
aagcattacaagcaatgattacaagccttacaacgccaccgcgtgtccacctaccatata
agcagtggaatttcccagaaacctttgcgctggagaagtataaaaggcaaagcgattccc
tcattcggtctcattcttccgcggtgatcctctgagtagccaggtattaataactattta
acttattttattgtagtgtttgaggctttaatgtcgtattaaacagtatttccattatgt
aatattggtttatacttaaagccgatgttgttttgcaataagttattcatattcattcaa
aatgtcttccacgtgctacaggcctcgggggcacgctaaaatacaactttatgcaagttt
ttcttagaaattgtaacctgttttgaccttaaatcattaactaaagctgttgacaaacac
gtatttgtattccatttaataatcgcgtggtttgactgctgcttaaggcctcgtgtttac
ttgtatgatgaagaatatgttggtagggacatctgagaaaatctgatgaatgccaacatt
tctgacatgtagcaattaaaatatgctgactcctgtttgttcatgcagaacattaaagat
ttttctttttttttccaggtcgagtctttcaattatcttaggctaatgtggaacagcagg
taagcaagtgttaactttaagtcgctactatattcgttgattgcctttgatgaattaaaa
atgtataagagtagtggacagaagtgatttctgagaacatttttaatctgaggcattgtg
aaactaccaaatggatctatcattaaaagttgcagtttttacctccttgcatatgagtaa
tgaggtaataatttgcagttacattaagttaataaatatatttcttttctacagatcctg
agtctcaagtgttaaaaataaacaccaggtatacaagttttattatttgtttttatatct
tctttgcctatgatgaataaaaatgtataagagtagtggacaggagtgatttctgataat
ttttactctgaggcattgagtaatttacccaaattctgcttcctttttgagttttctatt
gaacaaagatttactgaatgttcgatttcatcaatgtttttccttcaacgttcttttaga
ttcttgttcatgtgaataaactttcactttaatgattaatttgggttgactccacctctt
ttaaagatttaccatgtctttgcagcattgtaatgcaagtttttgcttttcaggactctg
ctgttggtctgaatcatctccaaggtatcttgatttgagtgcttttgctttagttatctt
gtatagtgcatatgatgaccctatttgctactcttgatttcatgctgatgaaattgcaac
caccaaaataccttgtctgaagcaccataaaccaatcttttttttttttttttttttttt
tttttttgtccattttgatatttacaagttctcttttctttgcagggtcatgtgctctgc
agttcaacttgaaggtgagtttttaaaagttctgactacagagtggcatttttcttggtg
ttattgactgtttatgatgattgttaaatgaaacaatgggaatctctctgaattagactg
aaagagacatctttatgctgaaacagtgctttattaagacgcctttgttagatttttgtc
ctgtactaatggtttttcacttctataggttgcctaaaaaggtggatcaagctgtatgga
gatggcgtcagttgacttgaggtgggtgtttatgagcatctccaattagtctctgcagat
gggcatcaactcaattgttctggcttattgcctattgctgttcatgatgactgttttata
acattgggaatctctctgaataagactgaaagacctcattaataaactgaaacagtacag
tttaaaatacttaggttttcttttcttcgttgtgtggtattaattaattttattttttat
ataggttccccaagaagattgaaaatgtatgaagactccagctgatatggtaaacaaatt
gttgtctttaagtgagaagttaacttttaattgtgtagtatctcaatgttttagtaaaat
tgtaatgcaatggtgcccttttttccaaacttgacttttataacctaaattctataacgc
cacccctaattgtgatgcaaatgatgactgcatagttcagcagaatttccatgtagaaca
cagagcaatgtctttcgctcctagctgatgcatcaccacagtcctatttcaataatgctc
cactcattgcccatgctcacttgttgtttctcattgcagcaagatgtctgcatgtggcca
atcgtttcaggtgagtcttagtctgccatataaccatcctaaaatgtgatgcagatgatg
actgcatagttcagcagaaactccatgtagaacacagagcaatgtctttcgctcctagct
gatgcatcaccatgcaaaaattggtctatatttgaagcttatttgctctaatgtctagtt
tttgtgttgcagattttctgacttaaaatggagatgaatgacccgtcattaaagtagtct
tcatggtgagtgcacatttaaagtgttgtaaccgaagcaaaagtggtctcaagctgatga
gtgtgaatcaggtctctgatctcattgaggacatggaagcatttctgatttaagactgat
tagaagtgagctttaccacctcaagctaggtagattttaatgggttgaatcttgttttag
gactcccatccagtatcttcatgactgccatccttgtaagtattgctctttgtagtggag
tccttcagatcttgactagtgtgatgaatctgatgtccactgacttaagccatggaggat
ggatattagctctgtctgatctggtcccgtctaaattctgagcctcattgtgaatgtttt
gttctaacaggtgtcttgttgacaggtacagtggccagctctccatagtgcaatatgaag
aatgttacttggaggtttgttcacacctttttattctgttttctttaagttttgggtttt
gtgatgctctacaaatgtctgacctgaatgcacagtgtggatttatctttgactgaaact
caagccctggactgggctcaatggttgactttgaccaacttgccaatttttttttttctc
ttttcttaaggtgtccaaagggcttcagcctctgcagttttgaaaagggtatggttttcc
catgtttgtgttcagtgtcttgtaacctgtgatgaaatgattctgccaaatgaatcctaa
tgattataccccaaccgttccatatttctgaggttaacttgaacttttacttgaaaccct
taaagtttacatgttgctaaatttatttgtctttccttgcaggatgaagttgagttcatc
tggttgactttttgggtgaagtttcagttgcccctccctttgttcaaagggcctcatcct
ctgtaaaaggtgcgactttgccatgtgattagtctgtcttgtaacctgtgacgacatgat
tctgccaaatgaatctaatgattataccccaaccgttccatatttctgaggttaacttag
acttacttaaaaccttgaagttttatacattgttgtaaatctctccctttttccttgcag
aatgaagttgtgtgcatctgcttgactgaggatttttttcaatggaaatgtgtttttttt
ttttatgactttaataaattgctattaatctgaagttggtgtgtgagttaatctgcatta
agtgtggtatctttcaatgtattgcacggatagttgcaagtatgatttaaatagttaatg
taaactcttgagtggattttattttttatttttttctcaagaccataaaccacacacaca
cactgttccctcaagaccataaaccttttatatatatatatatatatatattagagtgtg
tgtatatataaattctcttttccctcaccgtaaacctatatgttatatatatatatatat
atatatattttttcttggccataaactttttatatatttttttttttccttgaccataaa
tagaaattttttatttgtgtgtgtttatggtcttgagggtgaaaatttatataaatgtgt
gtgtgtatatatgtattaaaataaaaatttcccctcaagaccataaaccatatacataca
aactacaaataaattatatgaaataaaagtttagccaaatctatctgatagccacccaaa
ttcaatgtgggcgtaaagtggtttaagcaagctaatcgggaaagtcgtagttgactgtga
ttggtcctggctgcttagcgttgagaagagtaacaattaccccgtggcgttcacgttcta
aaaaaacgtattttaatatacgttttaccgctattattgaagaatggcttgctatccgtt
aaaaatcaaggagaacttgtttttaaaaaaaaataaaataaaatccattttactgaccca
atgcccgcccatttaaccctttacaataaccactcaggttctactattacaatgaagact
gtgacgtcgcgtttcagttgcggcctgtcatcggtgagactcggatgtgtctgaatggac
gctgcagttaaatcctatagctcaatgttacattttttactagctatatatttctgtcgg
caccgatgttttccttggtaatcgtgtcatcactcctggctgtttcggctaatgcggatt
ttttccaattcgaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1518..1558, 1794..1827, 2153..2183, 2385..2413, 2608..2660, 2884..2928, 3219..3249, 3432..3484, 3660..3694, 3865..3913, 4090..4127, 4302..4388, 4560..4653
NC_007119.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved