Danio_rerio Locus Poly:7:U8
snOPY snoRNA Orthological Gene Database
Danio_rerio Poly:7:U8
Danio_rerio
Poly:7:U8
10
U8, U8, U8, U8
1001..1133, 4452..4584, 6424..6550, 8400..8532
9532
gaaacccaaccatgattgaaaaagtatgcttagtttacaaaagcatttcaagactttcc
tcaaatctgcatcagtgaggtttatccttgcctgtaatcttagaaataagtctacagtat
atgatgattggattctaagaataccttttatattttattctgtgttaaattggggtatat
cactcatttatgaatcctgtctggtctttgttttgttctaggtaaagtaaactgtaaaag
catttaatattatgtttacaaaggaaggtagtagtgtatttttgtcatgtaatcaaatgt
ttgtatggcaatgctttctggcagggtatcctagaaagtaactgtcatgacatatgtttt
acacaaaagtgggaaatttttattactacattatcaaacaactgcatcgtacactaaaac
aaaaaaagaaatattttcaaataatgtgagatagtttcataaacatttgctcatgacaat
ttctgaaacctttattgcattattgtacagaatagcagtaaaactaccagctagctaact
gaactgtctaaaactcaacagtaaatataaatttatcagtctgttttatcaacttattaa
tacatgcttggtatgcagtggtaactcttttttaaattaaatactttttaattgttgtaa
tattttatagagatgtacaatattgggaatgtatttataaataagtatttgtatttattt
tacaattccacaatgctgtgtgaaaaaaaaaataaagcaaaaagacagctgctttcaaaa
tccaccaatagtatcgcaggagccattagcatgctaacaaagaaactcaatttaacattt
gaagttgactttaaaacattaggataaaactgttaatatggactttaaatatatgttttg
ctttataattggcttgcgtttagtttaaatgttagaaacacaaccacaattgaaaaagca
tgctcagtttacaaaagcatttcaagacttccctcaaatcagcatcagtgaggtttatcc
ttgcctgttgtcttagaattaagacttcagcacatgatgattggattctatgaatacatg
attatactctgtattcatatagggcttgtcacccatttatgaatcctgtctgatctttgt
ttggttatgtatatattaaattgaaaacaacttttgatttgatgttattacacaaaaata
ttagtgcattttgtaaacaaatacttgtgtgaaaatgttttcagcagggtgtgctagaaa
gaaactattatgacatgttttgcacacaagtgagaaattttgtattactacattatcaaa
caaatcattgaacactgcatcaaagaaaatttttttttcaaataatgtgaatgaatagaa
aggattgttttctgctagaaacatttgcatgattgtacagaatagcggtaaaactaactc
aaatgtgtaaaactcaacagcaaatagaaatttatcagtctgttttgttaaattatcaat
acatgcttcgcagtggtaactttttttttttaattaaatactttttaattgttgtaatat
cttatagaaatgtgcaatactgtgaaccggtgtatttattttacaactccgcaatgctgt
aatcaagaaagaatagcaaaagacaactgctttcaagatccaccaataggattgcaggag
ctgttagctcctaatataagagctgaaagaatcagaatgtagcatttcaagtataattta
aaacgttcaaataaaacagtttatatggagttaattattaaatgtatagctgtataattt
gcttgtgcttttaatggtttaagcattagaaacccagccatgattgaaaaagcatgctca
gtttacaaaagcttttcaagactttccacaaatcaacatcagtaaggttttttcttacct
gttgtcgtagaaataaaactatagcacacaatgaatggattctatgaatatttggtaata
ttctgtgtatagggcttgtcacccatttatgaatcacctctgatttttgttatgtcgtaa
gtaagttcaactagaaaaagcagctttgaattttttgttattaaaggaaaataactatga
catttttgtagtataaacagttgtttgtaggacaatgtctactgctagtgtgtttaataa
aaaagctattacgcatatgttttgtgcctacgtgaaaaagcttgtattattacattatca
aacagctgcattgtacacagcatcaaagaaaaaattatttctaataacgtgaatgaatag
aaaagattgtttcatttgctactgacaatttctgctaaaaacctttgcattaacgtatag
aatagcagtaagactaccaactaactaagttaaatgtgtgattatatctgtattcttaaa
ggttctgtcacccagttatgagtcctatctgaaaaatgtgtaaaaccactcagtcacaca
gcacagcaattagtaagtttttaattaagaggctaatttgttggtgtcatttgtacaatt
tagaatgattagtttatcctctaatgacggttgggtttgggagtagggtttactgaaaaa
agtgatatccgcaaaactgttgctaacaaattatatgggttgagtttaaacaaacaaata
aaatgtagtaatgttcaacttatttatttgttttaatttagcccaaataaatagttcaaa
ccacttaacgtaaatttttttgtaaatcttttttagcaaatctttaaatctttgaatatt
ttttttagtgttgggttgtatgcctcctttttaaaatcatgtttttttttgaatgactga
atttatgcgaatttgccacaaaactacaggcagaaaatactgaaaatacagatcaggctg
ataaaaccagacaactaacaaaaattcacagatctatttttttaaatgcatatttttcac
cttagatagaaatattatgcagtgtatgttttatgcatgtattgatgtgtgtgtgttttt
taagaaaacttaaatctaatactaatgttttgtgttgtggtcctctaatcattttctttt
catgtaatcagcaacttttgtgtgttcacatgtatattcatataacggttcactgaggcg
tacgtcacaattcttagtataagaggtttcttcaactacattgcagctttcacactttca
catttgtctgaatagcaaactgtcagtgtaggtacttaactgtgaataaaaagcatgtta
tatatagaacgtgtcagtttaaatgcttctgcagtttcagtccaattaagggccataaac
ggcatgtttcacgtaagaaaataaaccattacactgtataagaacagtaggaaagaaagt
attttaaattcattcattttccttcagcttagtccctttattcatcaggggttgccacag
cggaatgaatgccaacttattcagcatatgttttacacagcagatgcccttatagccgca
acccagagatgggaatcatacgtatacgtttattcacacacactcatacacgatggccaa
tttagtttattcaattcacctatagcacatgtctttaaactgtgggagaaaccggagcac
ccggaggaaacccatgtaaacaaagggagaacatgcaaaccccatacagaaatgccaact
gacccaggcgggactcgaaccagaaaccttattgctattaggtaacagtgctaaccactg
agccaccatgtcacagccttcaaaataagacatacagtatagtgtaaacatattctcata
tgttgccctgatgtcactgtaaagtgacctacggcactaaattccgttggtgtacgtcac
tgacattcataaaatttctcatcatggccttgttggatgatgaaagtccacgtattgcac
gtttcgaaatctagtaggaagtcatatagtttcctttcatattattattattattttaaa
gtcttattttaagtctaatgaatttaaacacttattctagagcaggggaaagggcatttt
agatgcagccaatatgctgactgtgtgtcatctcagtgaagactttttttataaaatatt
ataaatatttataaaatattcattaatagttttaatattataataatggatatagatgtg
caatattttcaacatgtatttatttacaataccacaatgctgtatgcaaagaagtagcaa
aagacaactgctttcagaattcaccaataggatcacaggagacattatagcatgctaata
taagagctgaaagaatctgaatttaacatttgaggtttattttaaaaacaatctaataaa
actgtctatatggactttaaaaatgtcactttctaactgacctgcaaattttataattta
aatattagaaacccaaccatgattaaaaaggatgctcagtttacaaagcttgtcaggact
gctgtcaaatcagtatcagtgaggtttatccttacctgttgtcttagaaataagactgca
gtatatgatgactggattctatgaatatgtgattatgttctgtatttgtacatgacttgc
aacccctttataaatcctatctgatctctctaatattacttgttcaaagttatagtatgt
cttttaacttttaaacttaaacatgtaaaacttaacagcaaatagaaattcatcttttga
gcactatagcttactatgcagcactgaaaagtatgttttaaatgcagccgttatacagtc
acaccagcggggactttttggataaatattttttatattcttttaatattctaatatttt
atataaatgtgcaatattgtaatgcatgtgcttattttatgataccacaaagctgtgtga
aaaaaatagcaaaaagacaactgctttccagatcccccaataggatcgcgggacatttga
agggtaactttgaaatgttaaatacttgaagattaacaaatacatttaaaaataaaactg
ttaattcattcattcattttcttgtcggcttagtccctttattaatccggggtcgccaca
gcggaatgaaccgccaacttatccagcaagtttttacgcagcggatgcccttccagccgc
aacccatctctgggaaaaaactgtttacatagactttaattaaatatattactacattgg
cttgcgttttttaatagtttaaatgttagaaacccaaccatggttgaaaaaagcatgccc
agtttacaaaagcttttcaagactttccataactcagcatgactgaagtttatccttatc
tgttttattagaaataagactacagtataagataactggattctatgaacatgtgattat
actttgtattcatataggactctttatcaatcctatctgatttttcttgtttttattgta
caatatatttattactttgttcaatttgcatatcacaacagattacacaattactgaaca
ataatcatgaaggcacagcaaactttttaccccccattctccctcccaacaaccctttcc
cttaaaaattaatcaaataaataaataaataaaataataataaataaataaataaataaa
ataaaataaataaacaaataaataaatataataaaaaaggtaagaggaaaaaaaagaaaa
aaagggggatatgtttaaatcaggagtgtttcctgagtctgtttagaccatgatacatcc
catattcctaagcttgttcttgttgactgtatctgatttttcttgcgttagttaataaaa
attattatgttctttagaaagttacttcttactataaaaaagaaaagtacgaaattttgc
agatcttacacattcacaaacaactacatgctgcataaaagaacaaatatttttaaataa
tgtgataaagaggaatagactgtttatttttcacagatatttactgctgatcatttttac
tagaaaccttcatattaacaaatagaatagagatttaatactagcctaaacagaacttag
aatgaaccaaaatgcataaaggaagtggaaatgtatcttttgacaacaagcattcaaaca
tggaaaaaaataagttttaaaaaatagtttgaatattctaatttctataaaagtgcaatt
ttgtgaacagatgtatttattttacgataccacaatactgtataaataaaatggcaattt
cttttccatttctttaaatctttcaaactccaccaatagtatcgcaggagccgttagcat
gctaacaaagaaactcaatttaacatttgaagttgactttaaaataaaactgtttatatg
gactttaaataaatgtgtaattagttattaaataaggcttttaatagtttaaatgttaga
aacacaatcatgattgaaaagcatgctcagtttacaaaagcttttcaagacttctttcta
atcaacatcagtgaggtttgtcctacctgttgttttagaaataagactttagcacatgat
gattggattctatgaatatgtgattatattctgtattcgtatagggttcacaactcagga
tcctatgtgatttttcttgtgttaaagacaaaaacattatatagaaagttacttctcacc
acagaaaaaaaatcttattcaagtttctgttattataagaatggcttctgagtttttcta
agttgagtgagtttatttgactctctttttagctttaaaaatacagtattcattttgcac
aggcatgtttgaaattttgcagatctttcacattcgcaaacaaatatacgctgcaaaaca
gtatgaataatttcaaataatgtgataaagataaatagactgtttatttttcactgagat
ttacagattattttttgctagaagccttcatattaacatatagcaaagagatttaatagc
aatttaaacagaactataatatgatctaaaatgcataaaagtcaatggtaaatgaaaagc
tatcttctgaaaactactattctaacactgaacaatgaagctttatgtggagtcaatatg
ctgactgtgtcgttagtggtgactctttttaaagtactttttaattgttttaatattcta
atatcttatgtaaaagtgcaatattgtgaacagatgtatttatttaacgacaccacaatg
ctgtatggataaaatgacaatttcttttccatttcttcaaatcttttaaaatccaccaat
aggattgcaggagccgttagcatgctaacaaagaaactcaatttaacattttaaagttga
ctttaaacattcaaataaaactgtttatatggattttatttaaatgtatcactttgtact
tggtaattaaataaggcttttaatagtttaaatattagaaacacaaccacgattgaaaaa
gcatgctcagtttacaaaagtttgtcaagactttccttaagtcagcaacagtgaggttta
tctttacttgtggttctggaaataaaactatagtatgtgattatattttgtttgaaatag
agcttgtcacccatttattctatctgatatttcttgtgttaaataatagaagtaataata
ttaaacaaaaagttgccttttattatgaacaaattacattctagtttatgttattaaaag
taaaattagcttctgagtctttctaaactgagtgaatattgtagttttagccacactaat
aaggcacaaattcatttattttgcacagagacgtttgaaattttgcagatttttacattc
gcaaacaactacacgctacatagaagtatgaatatttgcaaataatgtgataaagaggaa
taggctgtttaattttcaaagatttgctgatcatttttgttagaagccttcatgttaata
taaaaaactgagatttaatactagtttaaacagaacttagaatgaagcaaattgtgtaaa
accaacaggaaatagaaatttatgctttacaattagcatgcaaacaatgaagctttatgt
ggagtcaacatgctgactgtgtcgttagtggtgactctttttaattaaatacttcttaat
agtttaaattttctaatatcttatgtaaaagtgcaatattgtgaacagatgtatatattt
tacgataccacaatgctgtacggaaaaaaatgacaatttctttttcatttcttcaaatct
tttaaaatccaccaataggatcgcaggagccgttagcatgctaacaaagaaacacaattt
aacattttaaagttgactttaaacattcaaataaaactgtttatatggattttatttaaa
tgtatcactttgtacttggtaattaaataaggcttttaatagtttaaatggtgaaaaccc
aaccatgattgaaaaagcatgctcagttaacaaaagcttttcaagactttcctcaaatca
gcatcagtgaggtttatccttacctgttgtcttaaaaataagactacagcacatgatgat
tggattctatgaatacgtgattatattctgtattcttaaagggtttgcaacacctttatg
aatcctgtctgacattggtttaaatcattgctgaaagttttattataagtaaattactca
aaataaaaacaaagttatattaattcaaaaggtattctgtgtatccttacaaataatgag
ttaatgtttgtttggtattgtttacagcattaatataaaatgttattagtgcttcattta
tacatttataaatttataaactcaatttaacttgttaccttaaaatctgaaaacctggaa
atccaaactttcaaaaacaggttataaaagttacttaaaaagattttagtttccacaata
tacagcaaatggttttaaatataaaaatattcggaagcaaaaaataaatacttaaactga
aaaacaaaacaaaagtactgaaaaagtataaaagtacagaaaaaaaataatttttgcagt
ataatactcatgagatcatcatggcatttgtgaacaacaacaattttctacaagaaatcc
tgatgtaaacatcaaatcaaaatggagcagatgaagctatgagatggttctggaacatgt
tttctggcactgtgtctgtgtgtctgagcttttgctgtcagtctatgctaaatagcatgt
atatggactgagctgctatagagaacgcaggtcatgctagtgttagcgaggagaaagcag
tttaataattcagtggctgtcattcagagcaggcgtcagccattttacccacagttcatt
cactagagagactgtttgttccctcagcctctgttgacattgtgctttacacaagatatt
ttgaaaatatcattattaacaatatttaaaactagtagattgagaggaaactgtgtacga
ctgattagccctgaaaaattagcattagcagagtgatataaacaagcggtaagacttcat
tttgatggtccagttgagtattagtagactgtctgcttaatatcggttgatactgctgct
aaacagacatttaaatgactataagaaactttgcaagtacatgtcaacttacc
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007121.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved