Danio_rerio Locus si:dkey-105i19.5
snOPY snoRNA Orthological Gene Database
Danio_rerio si:dkey-105i19.5
Danio_rerio
si:dkey-105i19.5
3
SNORD88
1392..1481
4301
tatatttccttaacttttttcaaaaataaataaatataaaacaaatgagggcagcacaa
tggctgagtgattagcactgttgactcacagcaagaaggtagctggtttgagtcccggct
atatcagtaggcatttctgtgtagagtttgcatgttctccccttgaccgaatgggtttcc
tccaggtgctccgattcgcccacagtccaaagacatgataaattggccgtagtgtataag
tgtgaatgtgtgtgtgtgtctgtgtgtgtgtgtatgttttccagtgatgagttgcagctg
gaaaggcatccactgcttaaaacatgctggataagttggcggttcattcagctgtggcga
ccccagatgaaataaagggactaagcgaaaagataattaatgaatgattgtaattctatg
acgattcatgataataaatgtgtattctttttgtaaaaccatgattcatttactaggatt
gacatttattaggctagttaataagttaatctgttaaaaagaacacaaaaacaaaacaaa
gtaaaaatgcatgtaaaaataaattactaaatgaaatacttacaccgcgtggtttccttg
ctttcaaaggttcaggctcaaaaaaacctgccaactcttgaactgacccaaatgtttttg
tttatttatttgccacattcaatgcaataatctgtatagccacattttaacctacaatta
aacatttttctgtttatcattttggtgagggcgatttcggtaaaaaaaaaaaaaaaaaag
agggcgatttcagtcacagagaaatatttaaagaacaatgtgggtatctacgtgattgga
gatacagttttaaaaatatatcagatgcatggtaaaacaaaacatctaaaataacccctt
catgtgacgaagctctcaaattgtgtaaaggcgatattaacggacgcctaaaggtcctgc
tcagcgtcgactatataaactgcactctgccttcagagagttctcagtgaacgcgggtgt
gcagtagcttgccgaggtgaggagttcgataatgtcttttctttgttttccctcttcaat
tgtgtatttagtaattacttttgagtgtatttgttatacgtgtttattttaaagtggtag
ttcataatgtattagtaaaagatgctcttttatcgacaccacgtggtgtgggtaaatgct
cgaaccttgttaatcttgctacgacgtacttgcacggtcgtttaaatgaaaccatcctgc
atttacttacttttttcctcgtatttttgtttcagaataccaagtatttagacgattcat
caagactgactggaggtgagatacagtgtcattgctcatgaagtaacttgaagtttgttg
tagatttgtgaaacgcttcagtgatgtttagcactgggctctgagttcatgtgtagacaa
aagtgcagttttgctcttgacatggcagaacctgagaagtgtaaatgtaatatgaagttg
tattaaagtaattaaacgtgacgagtaatcagccttttctgttcttctagaggggagtct
gctgagctgtgagtgacctgtggatgagccttttttatttttttttttcttccctgcaat
ttattttattattatttttttttttgcccgttctttttattgtgtaagtttcctttgttc
tctgaaaaccaataaatgagactttaaaactgcaagatctatattttagttttttttttt
aacattagattgaagccattttaatattaaaggggtaaaatctagaaagcatgttactgg
aaaatgtaggatttgagccctttgaggtacatgtggttcttgtccagcagtatacatttt
cttccttgtgaacaaagtctgggatttaaattttgtattaactcatatttaggaattgtt
ttataagtgtggaccgtttaaatttatttaaatcagtagttgaatgaggttaaaatggta
aagggaattttatttcctgcaacgttaagcaaatgtaacttttgaaccacttatgattta
ttaacattcttcaatatcttggtttaacaaactgaccagtttgaccaatttattttttgg
gttgaaccatctgtggaataagcatgcccctttgcataaaaatctgcatagtgaaacagt
ttgactgacgaagacgatcttgaatggctgcacttccactgatgttaaaaatgaggctac
tgcgattaggggaaaaagtactttgagaaatcaatcaatgctggagttcagttccagcat
ttaacaattatcgttgtcgtaacgttggagtctctccaacaaacttaccccaatctggca
ttttctaactggtgttaaaaagggaggaatgaatttattatttgttttttattaagttgt
aaataacagtaactgggcattagataaaagcaaaaaaactagtatggcaagaagtgttca
caatttataatccatactagtgtatatatattcatgttactagtaccctttccattaagt
aacaatgcttattagacagtagtgcttttttttttttttttttaaatacactagtgctta
cttattagacactttattagaaactgctacccatgtactgtttttatatactaactacca
gtacataaaatatgtactagtcccaactagaatacatactactagtcaactaaatagtaa
atatcttaaatctcaaaaaaaaaaaaaaaaggaattcgtgtttgtgtaagcactagtatg
tattctagttgggactaatacttaaaaacagttcgaacataatagtatctaataaaaaaa
gatctaccgtctaatgagtaagcactagtatctaataagcattagtacttaatggaaaat
ttactagtatacataaattagtaacagaatagttaccagtcactattaaaataagtacta
gagtctatgtaaaatgcactagtatctaataaagaactatagtgtctaataagtactagg
ccttaatagaaaatacactagtatctaaaaaaataagtattagcaacaggaaactagata
tagccagggttataaattaaatgtcaaaacaatttgccataaccaatggtttaaaaaaaa
aaaattccagaagccatcccaacactgtattttccccatgtaaatgcacccataaagtca
tcagttcattattagaaaccccaagaactaaaatgtgtgtattagtcaaaggagaaatgc
aatcctgagggggactccaggaatgtggctgagaacaacgtctttagatgaaaaaacagg
aagaaaaaaagaccaaggaaaatgtcaacatatttctgggaagataaaaaaaacttgcac
agatcgttgtctttaaaattccaaatcattttctgatcttaacttagtatgttgccttgg
taaagacagctgaatgatatttggaacgttgtgaatgagtctctcggttattctgggtgc
attccttttaaatggacagttcacccaaaaatgaaaatatcctcgccattcattctccct
catgtggttgtaaaccatttacattaaacaataaagtaaacagaccacaagccactcaaa
gtaattcctgcatcttttattataattctaataacctttattcatttcttaaaacatttt
catatgtgtatatgaataggtataatcgcatacacatatattctgtaaataacctcttat
ctgttcataatttcttcattttaaaagaaaaaaaaagagatgctttctgcacaccctgga
cggctactgcataactgctcgtgtgtttgacctgtgagctctatcccgtcccacactgtc
cagactctattggccatgtgatcttcaatgtgcgtgtattatgtataacagttataagaa
gatgttaaaaatatggcgtgtggagcttgagggcttagaaagaccaaaatgtcctatctt
ttttgccatggtccaatctttcattcagacgctaactagggaagagaattgtgattttta
ctccacctagtggacaatacaggtaagtgagggtatttaccagtcatcagggtacaacac
cagccgcgtttgatgtgaatcaattcgatgaactgtggaaagatgagacaacaggggaca
caggatgtgtagaaagcatgattccaatacacattaaaactcatgttaaacatttggaag
acagagattctttaaaactcggaatccttttttttccatctcagaataataatttcattc
attgtccttactgttatcaacatcactatacttaccagattt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 1295..1334, 1550..3301
NC_007114.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved