Danio_rerio Locus LOC108190128
snOPY snoRNA Orthological Gene Database
Danio_rerio LOC108190128
Danio_rerio
LOC108190128
5
U3
2231..2329
3758
gccaagtcacaggtattaaatgtgtgttgctggtatatgtgtatgtttgtgtgtatatt
ttatataaactgccattagctattgactttgaaacataattgttcattaaaccaacatgg
catatgctaaaagtcttctttaatgttttagtatagaagaaaagtcacctacatcttcat
ttttaggctcaactgttgtaaattgtatttataacattctttcattcaaatatctattat
aatgttatgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtggcattcacagagctgcattag
actgatcctggttattagtatctgttgttcactgtcagcatgtgagtggtcagatttcac
agctgtgattggcaggaacacgtgaactgaagctgctgtccatgaggccactcgctgcct
gaggaagccactggaaatgagattaaagcaagtgtctggttataatgcaaaaactgtttt
tctttaatcatcatgggatgactcttggtgactttttttcacactattaaaaattctgaa
catgatttgaatgttagagggtcaaaaaagtcacagttgggtcatttgctgtcaaaaaaa
tgaagaaacacgagaaaaacaaataaatgagaaatcatatggttttgtggtaaatcagaa
caaaagtgtgcaacaatgaggcactgaaatatcaagcgctcaaaatgtacacatactctc
tctctcacacacacatacacacgtgcaattaagtgcaaatttaagaatatgtgaaacaaa
ataagtctatccctttctccgtcatacagccacacacaatttgtcttatggaatatttaa
gtctgcatttactgacttagatggaatatataattaattgtcactatagaaatacctttg
tgacagtaattagttgtctaaaatgatgaatccctcaggcttcatcggtaattgaggtga
agctgctccctgcacaggctaatgatgatgaagtgtgaacaggtgtgttgtaaagcgtaa
tcacttcacgaacgtcatttaatcgttcaatgactcaacaaataaaagcagttttgacgg
tgttgcagggaaacttctttcagagcgactgatacggttttttttttgacgacgacgacg
acgacaacaaaagaataagaaaaaacggctgaacatattccaatgtaacttctcaatcat
ttattaacttctatttgtttatttttataaaatagtcacatttgaagggaaaatagaacc
aaagactattttagcctttcgataatgccaaaatcatgataacaggctagctttagagcg
ttttcacttaagctgatttcgtcaactagcctactcgtacgtgcggccattacactcgac
agctactgaaagcgtgcttctctctagaccagggatgtcaaactcaattcctagagggcc
gcagccctgcacagtttagttccaaccctaattaaacacacctgatcaaactaattaagt
gcttcaggcttgtttgaaacccacaggttagtgtgttggagcagggttgaaactaaactg
tgcagggcttcggccctcgaggaattgagtttgacatccctgctctagactataagggaa
agggggaggaggggagacatgttactaaatcgtaaagaggagaacttcgtaacttgagta
tgaaacatgatattttggttcctaattaatacaacattaattttatagcaccagtaatct
gcaaaatatgcaagtttttatttggctcttgtctttacgttgttagaaatggctgatgta
accttaaggcatttggttcctttatttgttaaaattaactgtatgtttgaaggaaatggc
ttatttattactaaaggtataactagttaaaccttttatagttaaccatatatagtagtt
tcttgtgtttcatgatgccatcctttagtatcttccattcttgctgaaaaaaaaccccca
acatgctggtaaggtaggcctatgttgttcttatgctctttttgctggtctttgttagtt
aggatcagcactgaaaccagcaagaccagcatcaaaatcttatgctgttgttgtgttttt
ttttttttttctcctccagcaggtctgtattcagattttggctaaaatgcttttcagcta
ctttcaaaatgtaagatgtttaacagccagcaggctgattctgcagatgtttcttatgta
gcagagtttagctgcaatgatgagtgaaagaatgcatcttgacttggtattgttgctttt
tggcatcattgaccaaggtttgattgaggtttaatcttctctctgagctgctaacagatg
aagtttaaagaagtttgatctaagtgctgtttagcattgctgaaacctcaaaatgaagca
aagatggtctgtctatcactgaacatgtatattctttattttacagtgaggactttttcc
ctagtggcacaagttgtggattatgcagaggtctttctggaagattttggggagtggtaa
actcagactctcatgggtctgggaaaattccatggctctatttttagatggggagtatca
atgctccatttttaaacactcttataagggtcggtaaagggcgcttaatgtcctgtaacg
ctgttttgccaaattgcttgactaaaaaccatgtaactgatgaaatggtgaccactttta
ggtgggtaaactgcaaacttaaaatgtgccaaaataaagaacgtaaatttcacaaactcc
acattttcatgctgaggtttttcaggccattcacaaagaatttgactgtttcccatttta
tgttagctagtatacacccaagtaaggtaaaagttattttatagcacctttcacctattg
tctcttgcaaaatattgcaactgcttaacctttttgtgattttttttttattttattttt
tttaattatttttattattattttttaagatgctaaattttaacaatgcaattttaagaa
tagattgacactgtcagtctctaatatgtcttaaattcacatgtttttgactccaatcta
tgcattttaaattgcataaatcaactaaatatgacttttttttttctttactaaaaaagt
aaactgaagctttaatataaaggtgtaaattttcaagcatatgtgtaaaatgtaatttag
ccaattaatgtaataataaattaataattttaattcttggaacaaataatcagccttttt
gtttcagaaatggcacaatgtataatttcagcatcaatattgtaatgtgagaatccacaa
tagccacataacagaatgtggagttgatctggtaaaacagttcagaacacatgaagtctt
ttcagtttaacctaaataaagaaattatcagtggcatgtgtttttaaggcctgtaaatca
agattttaagtgaatttaaaacatttgtgcacattcttacaattgtagatttaacaaaga
tttattgtataaaatatataccactaagactgtacacagcgttattggacattttgatta
ttttatttatccctgaatactgatatgctttgtttgctctactgtatttatctatgctgg
taattttattatattttatgcactcctcaacaaaaccaccccaaacaatataaaatgatt
ctttccaactagagctattcaaaataactggtgaagttttatattacaatatatagctaa
atatcacaatgcaagttttccaatatcatgcagctctac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 2446..2758
NC_007116.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved