Danio_rerio Locus Poly:1:U3
snOPY snoRNA Orthological Gene Database
Danio_rerio Poly:1:U3
Danio_rerio
Poly:1:U3
1
U3, U3, U3, ACEA_U3, U3, U3, U3
1001..1216, 3050..3266, 4798..5014, 6820..7036, 9630..9845, 12059..12275, 14492..14707
15707
aagtcgcctgatgcgtgaccagattctgcgggaccatctgcctgaagctagcagagagt
aatgtctatggcttgggtggatagagtcgctgatgaatctcttggctttcttcatgcact
gtctggtgtggatgtcctggagggaggaaggctcacctcctactatgcgtccaccatttt
gcacaatcctttgtaggcctttgtgattgctgctggtgctgttaccatacaaggtggtga
tacagccagtcaggatgctctccacagtctctctcctgaaatccaccaccagcttcttgg
ttttcctaacaacactgcgtcagagtgtgcacctcctctctgtaggttgtctcattatta
ttagtgattaagcccaccaccaaagaaaaagaaaagaaaaaaaaacacagaggagagggt
acaaaataatcaaattgcatacaaatatattactcacaatttaccaattttagttattaa
caagaataaagctacggtcacacaagagtttgtgtctacgatattctgtcgtgtggcact
gtggaaaggggcgagaataaacaagattattaggcattacaaaagcgagcgattgctcca
tgttttgaatttctgtccagagaggtcctgttttgatcctctattggtctcacgcagtca
agtgatgcgttttcgcaggtcagagttcactaagcttgaactttgcaccgcagcaacctg
accacaggtttccggtctgatgcattagcgtgcatatgaatggaagtttatgggaagaaa
agcccagtgtgactgcagctttattaaatgcatttttacagctgcatgttttcaaagtgt
tcacaaattttaagcgtacatcatttaaagaaaaaaataaactttgcaggtgttttctaa
tcactgtttcatgaatgtgagtgagttctcgtgttgaagtaaccatctctaagactgtga
gggtcggaagggactccagctccttctgcagttggaaagttaagactatactttcagtga
tcatttctatagctcttaactaggaaatgtgtttctaaagtgatgagtctcccaaaccac
gatgatggtttttgatactcttttctgagtgtgaatcagatgcagagagttgatttaatt
tacttgctctgtatcattgttgaatttactttgttgtgtcttacaacataggaggaatag
agtatgaactgagtggttcttaataaagatatcactattagacttaaccatttatcaata
cttttcaataaaatttttcaacattggtaacaattatggattagatcttagttaataaat
tgtgaattgggctgtatttgataaataaagttctgttgttgttgtcaaacgaacagtgat
ataggtgtagactttaacaatgtgtatctatattttgaatgctaaaaatgttaccacata
gagtagaagtacacttaagtctacaatttaaccactaaaatgttaatcaaagaatattta
tttgaggtacatctattggttgaaaacaaaccaagagttgagattaatatgacgctaata
aaaacagtgaagggaaattggtaatacatatttcatggaaaccacatcctaaagaaatat
cttattaaacataacattattattatggtagtgatgggagaaaatagcttttcaaagctt
cgaaacaaaccaatgagctaactgcacagctagtgttcttcagccaattatatactttct
gtaaaagtgctccgatcacagcaaacacgattgtaaattccaaaaacgcaccatgctgcc
tttatgtgagatgtgttaagtgtttatcagcctgatagtcatagggaagaagctttcctt
cagcgggctggtgagtgatcggattctgcagaactgtctgcctaaaggtagcagagaaaa
aagtctatggattgggtggatagtagtgatgggtcgttctatgaatcttcaatatgacca
gaaactacgagtcctctcagggagtgatttgtttatccgcgcatgcgcacatttgtgcag
gtggtatcgttcatttcaagtaatttgagttgttcatcacggaaaagcagaagccaatcc
tatgcgtttagagccgaaaaaagaattgatccgttcatctctcaagtcctcgggtttgag
ttattctgtcacgtgatgaacgaacgactcaagaaccagaagacttgaaaggtgaactaa
ttatcatggctccaatcgactcagactctgtacattggtcaagattatatgtgactgtca
gtgtaacgtgaacaaaacactgacatttgaagacatgaagaggtgagctgagcaaagaga
caaaaataccttcatagacaaaagagcaggtaaacattgaattattattttctccttctt
atagtattctatttatgacttatttgtcgtgtggtcaacctttttggctagttgtagatg
tgtttggaaatcacatacaaatatattacacacaatttaccaatttaagttattaacaag
agtaaaactacggtcacactagagtttgtgtgtgcgataatctgtgtggcgcagtgaaaa
gggacgggaataaacaagattattcagcattaaaaaagagagcgattgctccatgtttta
aatttctgtccagagaggtcatgttttgatcctcgattggtttcatgcattcaagtgatg
cgttttcgcaggtcagagttcaccaagcttgaactttgcaccgcagcaacctgtgaaact
taaagcatgaccacgtgtttccggtttgacgcattcgcatgcgaatgaatggaagtcttt
ggaaggaaaagcccagtgtgactgcagctttattacatgcatttttacagctgcatgtgt
gaaagtattcacatattttaagcgtacatcattttaaaaacaaaaacgttggaggtgtta
cttttctaatcactatttcgtgcttgtaagtgaatgctcgtgttgaagtaaccgtcactg
agacagtgagggtcagaagggactccagctccttctgcagttggaaagttaagactatac
tttcagggatcatttctatagttgttaactaggacatgtgtttctaaagtgtggagtctt
ccaaaccacgatgatgattcttgatactcttttctgagcctgaatcagatgcagagaaat
gatttaattcatattctctgtatctttgatgaatgttccttgttgtctcttacaacatag
gaggaaaatagtatgatctgagtggttcataataaacatattattaacatacctaatatt
ctgtaaatgcctgtcaataaatattttcaacattataaacatttatggattttatggtag
ttaataaatcattaattatgctgtgtttgataattaaagttctgctgtttttgtcaagag
aataattatgtagactgaataggtatatagctatatagtataggtgtagactttaacaat
gtgtatctagtaatttgtaacattttaataatgttttggcaagttgaaccaaattaacaa
aatgactcgaaaaaagatttgttcatctcgatgaacgagactgaaagatccgagacagta
taatgatccgaacttcccatcactagtggattgagttgctgattattctcttgactttcc
tcatgcactgcctggtgtagatgtcctggagggaggttcatcccctactacgcatccagc
agtttgcacaatcctatgtaggcctttttgtattactgctggtgctgtttccatacaagg
tggtgatacagccagtaaggatgctctcctcagtgtaggtgtagaacgagcgaaggatat
gggggctcgttctaaaccccctgagacacctgaggaagaagagccattgttgtgcattcc
tcagcactgcatctgtgtgagcagtccatgtcaaatcctcagtgatgtggactccaagaa
acttaaaagtgctgactctctctaccgccgtccctttgatggtgataggagtgtgttctt
tcttctctctcttgaaatccaactccagctttttggttttgttgatgttgagtgagaggt
agttttcttgacaccactgcgtccagtgtgcacctcctctctgtaggtcgtctcatcatt
attggcaattaggcccaccaccaaagaaaaagaaaaaaaaacacagaggagagggtacat
aattaccaaattacatacaaatatattacacacaatttaccaatttaagttactaacaag
agtaaagctacggtcacactagagtttgtgtgtgcgatattctgtgtggcgctgtgaaaa
gggacgggaataaacaagattattcagcatcaaaaaagcgagagattgctccatgttcta
aatttctgtccagagaggtcatgttttgatcctcgattggtctcatgcagtcgagtgatg
cgttttcgcaggtcagagttcaccaagcttgaactttgcaccgcagcaaccgtggtcatg
cgaaacttaaagcatgaccacgtgtttccggtttgacgcattcgcatgcgaatgaatgca
agtctttgggaggaaaaacccagtgtgactgcagctttattacatgcatttttacagctg
catgtgttgaaagtattcacatattttaagcgtacatcattttaaaaacaaaaacgttgg
aggtgttacttttctaatcactgtttcgtgcttgtgagtgagttctcgtgttgaagtaac
cgtcactgagacattgagggtcggaagggactccagctccttctgcagttggaaaattaa
gactatactttcagggatcatttctatagttttaaactaggaaatgtgtttctaaagtgt
tgagtctcccaaaccaccatgacgattcttgatgctcttttctgagcgtgaatcagatgc
agacaaatgatttaattcatatcctctgtatcattgatgattgttccttgttgtgtcata
caacaaaggaggaaaagagtatgatctgagtggttcttaataaagatttcaatatcatac
ttaatatcctgtaaatgcctgtcaattcaacattattatattcaacattattaactttca
tggattttatgttagttaataaatcatgaattgtgctgagtttgataattaaagctctgc
tgtttttgtcaaatgtatcatcatgtagactgaataggtatatagtataagtgtagactt
tatcaatgtgtatctagattttaaatgctaaaaatgtaaccacatagagtagaaatacac
ttaagtctacgttttaaccactaaaatgttaatcgaagaatatttatttgaggtacatct
attggttgaaaacaaaccaaaagttgagattaatatgacgtgaataaaaacagtaaaggg
aaattggaaatacatatttcttggaaaccacttccttaagaaatatcacattaaacacaa
cattataattacggtagtgatgggtgaaaatagcctttcaaagcttcgaaacaaaccaat
gagctaactgcatagctagtgtttttcagccaattataaactttcggtaaaagtggtccg
atcacaccgaatgcgattttacattccaaacaagcatcatgctgcccttttttactgaag
tgtggtactgacaaaaatggcaactgaaacacatcttcaaactcttccaaacgtcaagca
cctaaatgtcgcttttagaaatactgaccactatatatttaatccaataataattgcttt
gttttttcaaaatcctcggatatgaggattccatttaactgccatcatttgtgtggaaat
gataaaacatatataaaaattataacaaaaataagcaattttacatttttactttttatt
attattctttttattaacaagaaccagcatgtacacttttcttatacaacaaaattactt
tacatttcttaacaacaaaggaataaataagaaaaataaagaaagaaaaataaatcaaat
cacatttattgtcacatcatcagcagcacgtgtgctatgatgaataaaagcttagctgct
agctcgagacaaatacaaatagtgtaaaacagagacattgcaaagtacaacaacatacaa
cagcacacttccaaaaaaacaggacaatgtaaaattggcagtgttgacagtgatgtgtac
aatgaacaggtgtacccatagctgtaggcagtattgttttaagtatggattggttaaggt
gcagagcatgctacatattgatggtgtgcagtgaggggtatggaagagtctgtgtgagat
gtgttaagcctgatagtctgagggaagaagctttccttcaatcggctggtgcgtcaccgg
attctgcagaactgtctgcctaaaggtagcagagaataaaatctatggcttgggtaggta
gactcgctgattattcttttggctttactcatgcactgcctggtgtagaagtcctggagg
gagggaggttcatctcctactatgcgtccagcagttcacacaatcctatgaaggcctttg
cgattgctgctggtgctgtttccatacaaggtggcgaatggaagtctatgggagaaaaag
cccagtgtgactgcagcttttttaaatgcagttttacagctgcatgtgttgaaagtgttc
acttattttaagcgtacatcattttaaaaacaaaaacgttgcaggtgttacttttcttat
tactgtttcatgcatgcgagtgagttctcgtgttgaagtaaccgtcactaagacagtgag
ggtcggaagggactccagctccttctgcagttgaaaagttaagactatactttcagggat
catttctatagttcttaactaggaaatgtgtttctaaagtgttgagtctaccaaaccacg
atgatgcttcttgatactcttttctgagcatgaatcagatacagagagatgatttaattc
atattctctgtatctttgatgaatgttccttgttgtgtcttacagcataggaggaaaaga
gtatgaactgagtggatcttaaaaaaggtattaatttcatacttagccttctattaatac
ttgtcaatgtattttattaatattgctagcaattatggatttgctcttagttaataaatc
ataaattaggctgttttagataattaaagttatgctgtttttgtcaaacaaaccgcgatg
taggtgtagactttaacaatgtgtatctagatttagtatgctaaaaatattaccacatag
agtagaagtacactgaagtctacattttaacaactaaaatgttaatcaaagaatatttat
ttaagggtcatctattggttgaaaacaaaccaaaagttgagattagtatgacgtgaataa
aagcagtaaagggaaattggaaatacatatttcatggaaaccacatcctaaagaaatatc
acattaaacacaacattataattacggtagtgatgggtgaaaatagcctttcaaagcttc
gaaacaaactaatgagctaactgcacagctagtgttcttcagccaatgataaactttgtg
taaaagtgctggcgaggcagtggcgcagtgggtagtgctgccgcctcaaagcaagaaggt
cgctgggttgctggtttgaacctcggcatttttgtgtgaagtttgcatgttctccctgcc
tttgcgtgggtttcctccgggtgctctggtttcccccacagtccaaagacatgcggtaca
ggtgaattgatagactaaattgtccgtagtgtatgagtgtgtgtgtggatgtttcccagg
catgggttgcggctggaagggcatccgctgtgtaaaaacttgctggataacttgggggtt
cattccgctgtggcgacctcggattaataaagggactaagctgacaagaaaatgaatgaa
tgaatgtaaaagtgctctgatcacagtgaacacaattttaaattccaaaaatgcaacatg
ctgcctttatgtgagatgtgttaagtgtttatcagcctgatagtcagagggaagaagctt
ttccttcagccggctggtgcgtgaccggattctgcagaactgtctgcctaaaggtagcag
agagaaaagtctatggcttgggtggatattagtgatgggttgttcatgaacgatttgttc
attttgaacgaattttcaatatgactcagaaactacgagtcctctcaaggagggattcgt
tcatccgcacatgcgcacatttgtgcaggtggtatcgttcatttcaagtattttgagttg
ttcaacgcggaaaggcagaagccaatcatacgtttagagccagaaaagaattgattcgtt
catttctcgagtcctcgggtttgagtcgtgatgaacgaaccactcaagaaccagaagact
tgaaaggtgaactaatcatcatggctccaatcgactcagactgtgtacattggttcagat
tatatgtgactgtcagtgtaacgtgaacaaaacactgacatttaaagacatgaagaggtg
agctgtgcaaagagacaaaaatacctttatagacaaaagagcaggtaaacatcttatcat
ttttttctccttatagtattatatttatgacttatttgtcgtgtgatcaaccttttttgc
tagttgtagatgtgtttgaaagtaattcgtaagattttaataatattttggcaagttgaa
ccaaatgaaccgaaaaaagatttgttcatcttgatgaaggagactgaaagatctgagtca
gttaaatgatccgaacttcccatcactagtggatagagtcgctgatgattctcttggctt
tcctcatgcactgcagtggagtagatgttctggggggggaggaaggttcatctcctacta
tacatccagcagttcgcacaatcctatgttggcctttgggattgctgtcagtgctgtttt
catacaatgtggtgatacagccagtcaggatgctctccacagtgcaggtgtagaaagagc
ggaggatatgggggctcattacaaaccccctgagatgcctgaggaagaagaggcgttgtt
gtgccttcctcagcactgtatctgtttgagcagtccatgtcaaattctcagcgatgtgga
ttcaaagaaacttgaaagtgctgattctacccgtgtcattttgatagtgataagagtgtg
ttcttttttgtctctcttgaaatccacctccagcttcttgattatgttgatgctgagtga
gaaatggtttccctgaaacctctgcgtcagagtgtgcacctcctctctgtaggtcgtctt
atcattgttggcgattaggcccaccaccaaagaaaaaaaaaaaaaaaaacacagaggaga
gggtacataattatcaaattacataaaaatatattacgcacaatttaccaactttagcta
ataccaagagttgtaaactgcattttacagctgcatgtgttcaaagtgttcacatatttt
aagcgtacatcattttaaaaacaaagacgttgcaggtgtttttttctaatcgttgtttcg
tgcatgtgagtgaatgctcgtgttgaagtaaccgtcactaagacagtgagggttggaagg
gactgcacctccttctgcagttagaaagttaagactatactttcagggatcatttctata
gttcttaactaggaaatgtgtttcttaagtgatgagtctcccaaaccacgatgatgattc
ttgatactcttttcagagtatgaatcagatgtagagagatgatttgattcatatgctctg
tatcattgatgaatgttctttgttgcatcttacaacataggaggaaaagagtacaaattg
agtggtttttaataaacgtatcaacatcagatttaacctactgtaaatatttgttaataa
attttgttcatggtgttatcaacaatggatttgacgtgaattaataagttgtgaactttg
ctgtagttgataattaaagctctattgatcttgtctaacgaattactttataggtgtaga
ctttaacaatgtgtatctagattttgaatgctaaagttgttaccacatagagtagaagta
aacttgagtctataatttaacaactaaaatgttgatcaaagaatatttatttaaggtaaa
tctattggtagaaaacaaaccaagagttgagattagtatgacgcgaataaaagcagtaaa
gggaaaatggaaatacatatttcatggaaaccacatcttaaagaaatatcacattaaaca
caacattataattacggtagtgatgggtgaaaatagcctttcaaagcttcgaaacaaacc
aatgagctaactgcatagctagtgtttttcagccaatgataaacttttagtaaaagtgct
ccaatcacagtgaatgcgattttacatttcaaaaacgcaccattctgccattgtgtgagg
tgtgttaagtgttcatgaccctgatagtcagagggaataaactttccttcagccggctgg
tgcgtgactggattctgcagaactgtctgcctgaaagtagcagagagaaatgtctatggc
tatgtctatgatattgttcatttcatgtattttgatttgttcaatgcggaaaggcagaag
cctatcatatgtgtttagagccggaaaaagacttgatctgttcatctctcgagtcctcta
ttggttttgagtcattcgttcctcacgggccaatcatatgcgtttagagccggaaaaaga
attgaaccattcaactctcgagtctttgtgtttgagtcattctgtcacatgatgaacgaa
cgactcaagaaccagaagacttgaaaggtgaactaatcatcatgcctccaatcgactcag
actgtgtacattggttcagattatatgtgactgtcagtgtaacgtgaacaaaacactgac
atttaaagacatgaagaggtgagctgtgcaaagagacaaaaataccttcatagacaaaag
agcaggtaaacatcttattatttttttctccttcttatagtattctatttatgacttatt
tgtcatgtgatcaaccttttttgctagttgtagatgtgtttggaagtaattcgtaacatt
ttaataatattttggcaagttgaaccaaatgaaccaaatgactcgaaaaaagatttgttc
atcttgatgaaggagactgaaagatctgagtcagttaaatgatccgaacttcccatcgct
agtggatagagtcgctgatgattctcttgcagtggtgtagatgttctgggggggagggag
gttcatctcctactatacatccagcagttcgcacaatcctatgttggcctttaggattgc
tgttagtgctgtttccatacaaggtggtgatacagccagtcaggatgctctccacagtgc
aggtgtagaatgagcggaggatatgggggcttattaaaaatcccctgagatgtctgagga
agaagaggcgttgttgtgccttccttagcgctatatctgttagagcagtccatgtcaatt
tctcagcaatgtggactcaaggaaacttgaaagtgctgattctacccgtgtgattttgaa
ggtgataagagtgtgttctttcttctctctttagaactccacctccagcttcttgatttt
gttgatgctaagtgagagatggttttcctgacctcactgcgtcagagtgtgcacctcctc
tctgtaggtcgtcttatcattgttggcgattaggcccaccaccaaagaaaaagaaaatta
aaaaataataataaaaacacagaggagaaggtacataattatcaaattacataaaaatat
attacgcacaatttaccaactttagctattaacaagagttgtaaactgcattttacagct
gcatgtgttgaaagtgttcacatattttaagcgtacatcattttaaaaacaaagacgttg
caggtgttttttttctaatcgttgtttcgtgcatgtgagtgaatgctcgtgttgaagtaa
ccgtcactaagacagtgagggtcggaagggactgcacctccttctgcagttggaaagtta
agactatacttttagggatcatttctatagttcttaactaggaaatgtgtttcttaagtg
atgagtctcccaaaccacgatgatgattcttgatactcttatcagagcatgaatcagatt
tagagagatgattcgattcatatgctctgtatctttgatgaatgttctttgttgcatctt
acaaaataggaggaaaagagtatgaactgagtggtttttattatatgtgtcaacatcaga
tttaatctactgtaattaattgttaataaattttgttgacggcgttatcaacaatagatt
cgacgtgatttaataagttgtgaactttgctgtatttgataattaaagctttattgatct
tgtccaacgaattactttataggtgtagactttaacaatgtgtatctagattttgaatgc
taaagttgttaccacatagagtagaagtaaacttgtgtctataatttaaccactaaaatg
ttgatcaaagaatatttatttaaggtaaatctattggtaaaaaacaaaccaagagttgag
attagtatgacgcgaataaaagcagtaaagggaaaatggaaatacatatttcatggaaac
cacatcttaaagaaatatcacattaaacacaacattataattacggtagtgatgggtgaa
aatagcctttcaaagcttcgaaacaaaccaatgagctaactgcatagctagtgtttttca
gccaatgataaacttttagtaaaagtgctccaatcacagtgaacgcgatttttcatttta
aaaatgcaccattctgccattgtgtgaggtgtgttgtgttcatcaccctgatagtcagag
ggaataaacttttcttcagccggctggtgcatgactggattctgcagaactgtctgcctg
aaagtagcagagagaaatgtctatggctatgtctatggtattgttcatttcaggtatttt
gatttgttcaatgcggaaaggcagaagcctatcatatgtgttaagagccggaaaaataat
tgatctgttcatctctcgagtcctctattgggtttgagtcattcgttcctcacgggccaa
tcatatgcgtttagagccggaaaaagaattgaaccattcaactctcgagtctttgtgttt
gagtcattctgtcacgttatgaacgaacgacttaagaaccagaagacttgaaaggtgaac
taatcatcatggctccaatcgactcagactgtgtacattggttcagattatatgtgactg
tcagtgtaacgtgaacaaaacagtgacatttaaagacatgaagaggtgagctgagcaaag
agacaaaaataccttcatagacaaaagagcaggtaaacatcttattatttttttctcctt
cttaaagtattctatttatgacttatttgtcgtgtgatcaaccttttttgctagttgtag
atgtgtttggaagtaattcgtaacattttaataatattttggcaagttgcaccaaatgac
tcgaaaaaagatttgttcatcttgatgaaggagactgaaagatctgagtcagttaaatga
tccgaacttcccatcactagtggatagagtcgctgatgattctcttggctttcctcatgc
actgcaatggtgtagatgttctgggggggagggaggttcttctcctactatacatccagc
agttcgcacaatcctatgttggcctttgggattgctgttagtgctgtttccatacaaggt
ggtgatacagccagtcaggatgctctccacagtgcaggtgtagaatgagcggagaatatg
ggggctcactacaaaccccctgagatgcaagaggaagaagaggcattgttgtgccttcct
cagcattgtatctgtttgagcagtccatgtcaaattctcagcaatgtggactcaaagaaa
cttgaaagtgctgattctacccatgtaattttgatggtgataagagtgtgttctttcttc
tctctcttgaaagccacctccagcttcttgattttgttgatgctaagtgagaggtggttt
tcctgacaccactgcgtcagagtgtgcacctcctctctgtaggtcgtcttatcattgttg
gcgattaggcccaccaccaaaaaaaaagaaaattaaaaaaaataaataaaaacagaggag
agggtacataattatcaaattacataaaaatatattacgcacaatttaccaactttagct
attaacaagagttgtaaaatgcattttacagctgcatgtgttcaaagggttcacatattt
taagcgtacatcattttaaaaacaaagacgttgcaggtgttatttttctaatcgttgttt
cgtgcatgtgagtgaatgctcgtgttgaagtaaccgtcactaagacagtgagggttggaa
gggactgcacctccttctgcagttgggaagttaagactatactttcagggatcatttcta
tagttcttaactaggaaatgtgtttctaaagtgatgagtctcccagaccacgatgatgat
tcttgatactcttttcagagcatgaatcagatgtagagagatgatttgattcatatactc
tatatcattgatgaatgttctttgttgtattttacaacataggaggaaaagagtataaac
tgagtggatttcaataaacgtatcaacatcaggtttaaccttctgtaaatgtttgttaat
aaattttgttgacagtgttatcaacaattgatctgacatgaattaataagttgtgaactt
cgctgtatttgataattaaagctctattgatcttgtctaacgaattactttataggtgta
gactttaacaatgtgtatatagattttgaatgctaaagttgttaccacatagagtaaaaa
taaacttgagtctataatttaaccactaaaatgttgatcaaagaatatttatttaaggta
aatctattggtagaaaacaaaccaagagttgagattattatgacgcgaataaaagcagta
aagggaaaatggaaatacatatttcatggaaaccacatcctaaagaaatatcacattaaa
cacaacattataattacggtagcgatgggtgaaaatagcctttcaaagcttcgaaacaaa
ccaatgagctaactgcatagctagtgtttttcagccaatgataaacttttagttaaagtg
ctccaatcacattgaacgcgattttacatttcaaaaacgcaccattctgccattgtgtga
ggtgtgttgtgttcatcaccctgatagtcagagggaataaactttcattcagccggctgg
tgcgtgactggattctgcagaactgtctgcctgaaagtagcagagagaaaagtctatggt
tatgtctatgatattgttcatttcatgtattttgatttgttcaatgcggaaaggcagaag
cctatcatatgtgtttagagccggaaaaagaattgatctgttcatctctcgagtcctcta
ttgggtttgagtcattcgtttctcacgggccaatcatatgcgtttagagccggaaaaaga
actaaaccattcaactctcgagtctttgtgtttgagtcattctgtcacatgatgaacgaa
cgactcaagaaccagaagacttgaaaggtgaactaattatcatggctc
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007112.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved