Danio_rerio Locus Mono:18:U3
snOPY snoRNA Orthological Gene Database
Danio_rerio Mono:18:U3
Danio_rerio
Mono:18:U3
Zv7_scaffold2594
U3
1001..1213
2212
AGGATTAGATCAGCTCAGTTCAAGCAAAGATAATACAGAAAGTATGTTCTGAATTCTGA
TATTTTCTTACAGTAGTGGTTATACACTTGGGAAAATGGTACATATTTTTTAACTATATA
TATATAAAGTTATAGTCATTAATAAAATAAATAAAGTTATACATATTAATAAAACGTATG
CAATCTGCACCCTCGAAATGAAAGTACAAAGACTGCCACCTTGTGGTGCAAAGAGAAAAC
TTATTGATATGAACTTTTTAGATTGCTTAGTACAAATTGTGTATGATAGGAATGCAGAAT
ATGTGACTTATTTTAAAGCAATAATACATTTATGCAGTCATAAACATGTTTTGATAGTTA
ATAGTGATTTGAAGCTTCACAAAAGTTGCAGCTGCCTTTACCAATATCAAAATGCTTTTG
TAAACAACCAGTTATTCTTTACGCCGATTAAAAAACGGCTACTATAATAAAGAAAATATT
TTCTAAATTTAGAACTAAATACACTGATATGCACTGAAATACATGATAAATACTCTTGAC
ACATGAAAGTGTAAAGCCTGCAGCTCACAACAAATGTTGAAGGTTATTGCGTGTCATATT
TAACAAGCCGTTTCTGCTAATTTGATGTAATTTTGCTCACATGTATAATTGAATATTAAT
CAGATGATGTCATTACGCTGCTGCAGCCAATCGCTGCATAGCTGATCATGATTTCGAGGA
TCGATAGATCTGTCCTTCACAACACACGCAGCGATCTCAGATCAGTTCATCCAGACATTC
TAATCTGATTCGCGAACTTGTTTGAAGAACCAAATTAGCGAGAGATCAGTTATCAAGATT
AAAAGATCCAGGATCTGCCAAATCATCTTAGATAATTTGGTAATATGAAGAGTTTGAGGC
GTTGTTTTTCTCACCAGGTTTCTCAGCTGACGTCATCGCCTTACCGTCCTCTAGTTTGCT
GTTGTCATTGATGGGGCTGCTGCCGAGCGCATGCTGAGGTTAAGACTATACTTTCAGGGA
TCATTTCTATAGTTCTTAACTAGGAAATGTGTTTCTAAAGAGTCGAGTCACCCAAACCAC
GATGAAGAGTGAAGGTGCATTCCTCTGAGCGTGAATCGGATAATAATCTGCGGGATAACC
ATGGATAATTATCATTGATGAACGTTCTGCGATTCTTAATGAATCTAAGAGGAGGAGTGC
ACGAACAGAGTGGTTCCTTTTTAAACTCGTCAATATCAGTTATAAACACAACTTTATTAT
GTCATAATTAGTAGCTTATCGTTGAAACTACATTGTGCAAAGTAGAGAACTGACACATAA
CAGCATCTTGGCAGCACCTTTCATCAGTTTATCTCACTGTCCAACTGAACATGATTGTAG
TTTTAAATCGCATTGGATAACATTTCACTCTATAAAATAAATCATATTTTCAGATTCAAG
TACATACAGAAAATTACATTATCAACTAACAAACAGAAACTGCGAATCAGGAGAAGAGAT
AGGAGGCTCAAGAGGCATGATATGGCTTACAACAGACTAGTAAATGAGAAGTGGGAAAAT
TTATCAATGTCTTTTTTTTCCCTTTTTGGTGTAACAAGTCACAAAGCTTCAAAATGTATC
GTTAAAAGTCTGTCAACTCAAAAACCCTATTTATTATTAAATCATTTATCAATATATTAT
AAAAGTAGATTACCTTATGAAAGTGGTGGTATTTTAGCGGGGTGAATTAGAACAATGTTT
TTTTTAAATATGGGGGGGTTGGGGGTCTTTGGGAGATATATCCAGCTGCAGGCCCGCAGA
ACCACACACGTTTTAGGCACACACAATCTAGGACACACGATTTAGGCAAACCATACATGG
TAACTAACTCTTTAGCATTATCGCCACCTGTTGAATTTCACAAATATGGTTTCCCATTTC
AGTCATTATTATTATTATTATATCGTAACGATCATTTTAACATCTCTGCAGTTTCTGAAC
TCAAATTATGTAAATAAAAATATTTGGTTAAAGACAATTATGACTTTATTCATGTGTCCA
TATACACAAAGAAAACATGATAGACGTGTAATTGTTGGATTAAGTGTAATAAACTAATTC
AAGCTCTTAATATTATCATACTTTTTTAAAATCACTGTTGTAAAATATAAAAGCAAACAA
TAATATGTCACTTTAAAATAAATTATCCTACTATAGTTAATCATTTAAACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved