Danio_rerio Locus si:zfos-1451h6.1
snOPY snoRNA Orthological Gene Database
Danio_rerio si:zfos-1451h6.1
Danio_rerio
si:zfos-1451h6.1
11
SNORD12, SNORD12, SNORD12, SNORD12
1570..1663, 1855..1947, 2128..2221, 2401..2487
3739
aacaaacagaatgggtatatacatcaaacattaaagaagaagatagcataatttacaaa
cttagatgttttcaaagccttttttgtaaacgagttagaaattgtttcaaagtaatactg
catttcagtaagcaatatataaaaaaaaggtttttggtttgaaaatgtacatttatgtat
atacaatcgtgttaataagataagaagattaagaaaatatattttctttttatgtaaaac
ttgttttataattaacaaaaccaaacaaaacattttcccatggtaagaaaagtcttaatc
aacattctcaatcacaaaaagagaaaaatctttaaagcaaactagaataactgcattgcc
aaaataagtgaacgagggaatcgggttgttacttacaaaatgaaatttttattttatttt
atttatttatttattgcaaaaaaaaaaactgttgacaagtttgttgcaatatttgtttac
aatacagaatatttcattgtcaatgaaaaaagatacaagagaaagaaagaaataaataaa
gaaataaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa
gaaagaaagaaagaaagaaagaaaataaataaagaacatgaaataaacttgagggtaaga
tatttaagaatcaattacagtacataagttaaagtcattacaaaataaaagtgttctgtt
tgctttcttatttttagataattaaataaaatgtaaataatcactaaattcttgcaaaaa
aaaaaaaacaggaaaatatggtttggtattagtaaatttgcaattggaatggaattgaca
aagaaattgacaaagtttataatgctttcccagaaatgggttgcagctggaagggcatcc
gctgcgtaaaacatacgctgaataagttggcggttcattctgtggcgactccagattact
aaagggactaagcaaaaagaaaagaaaaggaatgaattaagtttttttttttcttttaat
gattgaagtttataatgctgaaacaacgctctcgctgacgtaatggcttgaataactgcg
catgcgtagggactatataacctaagttcgctcattcttccttcccacttcctactcgct
tttgaggtaagctgagtgtatattgtaattattcataacatataatagtaagtacacgtt
gaataattgcattgtagaagtgtttacggtcaaatcggaagtatgaaacaacaaatcaga
attttgatgtaactatatgcgctggacacgtggctaagttcggcgcacgcgggaaatgtg
caacaatatatacttttgttaaagtgttgcatttacttgatgaatctggctaaaccgtaa
tcgttacataaacgttggtctgctacacaaatgctgcactataggcaatattcttaaacg
ccattattattagtattaattagctttttctttctttttatgtaggatgttgacttcgaa
atcatggagttttgcccttgcacattctcagatctcggtgagtattatttacaccgtatt
ctgcttaacttctggtagcaatgatgacttaatcttttttccccagcagatcgactctgt
tgacttgtgaaacgaaaataagccaaattatctgagcaaactgatggctataataaagcc
attgtttgttttaaataacaaattgaccatttgttaacatttccttcacaggtcatactc
caaccaaacagatgacccccacgtttaaaatggtgcaataataaccccatcatactctga
agcaggtaaagatggatctattttttttttttttagaccttttgtgccatttttatctgg
tgcacgtgatgactaaccttttttccccagcagatcgactctgttgacctttaaaacgaa
aataagccaaattatctgaacaaccagaccgctacaatagagctatggttttaagtattt
caatgcaactaaccattgtttaccgttcccttcacagatccctccccaaccaaatggata
ttcctgcatttgaaaggatttgagaaccccatcgtactctgaagcaggtaaagatggatc
tgttctttagaccttttgtgccattttatctggtgcacgtgatgactaaccttttttccc
cagcagatcgactctgttgacttgtaacacgaaaaataagccaaattatctgagcaacca
gatggctgcactaaaactgtggttgtataaatttcagtttcaattaacttgttacaattc
ctctcctcacagatcatacttcaatcaaatggatggtcctgaatttagaaggattcaata
accccattatactctgaagcaggtgtggatacatttatttttctgggggggctatttact
tggtgcacatgatgactgaccttttttccccagcagatcgatagtgttgactcccttaat
caatttaagccaatttatctgaagcaccttcagagctgatggacctaaaaagtagatgtg
ctctagtttgtaacgcttttttttttttttttctctccttctaaaggccaagacccaatt
caagatgatcaggggagttttacatgccacccaacatgttaatgccacaccttcagagag
aagcaggtggtccagtgtctggagaagagaatttgggtggaatgttacaaattctgcttg
gtgttgcagattagttctattaataaaccctggaacttaagtgtgtttgtttaattattt
atctattttttataaatggttcatattcaagctggaattttattttcaataaacaattgg
atctttaacctgactttttttttttttttttttttttttttgatctacaaattaagtttg
taatcaaatagtcacattggactaaataggtacaattacagtaagtttaatgtaattgca
caaaggtttgttaaagtttaatcacactttttttttttttttctaccctctttaagccaa
caatacccattattgcctcatacccacattatactttagtttgtcctaaactcaaagtaa
atatttgaatacacttaaaagaacataaaaacgtgctgcttatttgaataaattaccttt
ttggattgtcaaaaaaaaaaaacagccaccctacgtcacattaccgaaggaattatttta
tttcacaaatagcaaatagtttacgccacctatacaggggttgtagaaaacattgcccat
taggttcaccttattaattcagggtagaataataatttttttttttgtgtgtgtgtgcta
cgtagtggtaatggtgaaatgaagctttctgaactttccaattcaagtgtattggaaaaa
gattagtttcttgaagctttttaaatccgagctcgataaggatccatgttgtctaaagtg
tgggaaagcactgtgttgcaaaaaatgtcaaatgttcacaactgaccaactcattcatgt
agtcatacaacggtaatataaacaaattactcaattattgtaggtttttttttttttttt
acatataacatgctttatataacactattgttgactagtaaaatccaagatattggatat
ttcatatttcagtctgtcatactcctatccacttgttttgaatagggagtgaactgatgg
ttcctgtatgggaggctatcagagtgaggcttatgggctgcactcgccagctcagctggc
ctccgttacacttactacaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1145, 1485..1536, 1731..1804, 2292..2361, 2566..2739
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved