Danio_rerio Locus LOC100535890
snOPY snoRNA Orthological Gene Database
Danio_rerio LOC100535890
Danio_rerio
LOC100535890
3
SNORD49, SNORD49, snoR38
4144..4220, 5964..6040, 8109..8177
9544
gctgcaactcatctctgggaaacacagatacactcttgcatttacactcatacactacg
gccaatttagcttattcaattcacctataccgcatgtctttggactgtgggaaaactgga
gcaaccgtcaattacaacatttattaaaaaatatatatttagtaatcttgaaatagtaaa
aaataaaaataaatatataggttttgtgaagctgcagctttaatcggaaaatgtataatt
ctaaaacctagacctatctgtattgcaagtttaataacattttctactatcatatatatt
taaataataaataaataaaataaattgtgataattgcaattatgtatctttagtaacttg
tttttttttattacttaggctttattttctaaatttaaaactaaattctaaaattcaaat
tgtgccgtggattaaaaacatatgcatttgtaaataagtgactatatgtgattttgttta
tttacattgattatttatccatttatttaaaaaaaggttcagtgaattattcgttaatat
gtattattcatactattaataactaatcgttgtactaatattgaccttcattttgtaaat
ttaatacataaaaaaagaaacgttttggattatggattaaagaaattacattttaaaaca
tattttaattgtaattgtgttattagatgtgattttccacatttccagaaaattattcgt
taatcttttaatgacttttattttgtaaaacgggtctctttcgcatcccggtttccactt
ttgcagtgttccaaacatcgacacactgtattgataagtactaatgatgtccactatgta
gggtagatctaaactcaaaagtgagtccttgtaatgaacgctccccttctcaatctcagt
cgaagagagcagggtgtagggatgatcactactgaacacaacacgaccctcatcacgtga
atagtgacgttgctgagctataaaaccgggggctgcctgttcttcatcctctttcgctct
tcaactcgtggtggcttgggtttgtcctgacccaaaggagaattaatcgctattaaagca
tgtttacactaaatctaaaacaaaaatctgattgctattcgtctagaccgccatgataac
cgtaagtttgactattaagcgtgtttttagtcggagctaacttgaataatggcggtctgt
gtgcgaggtgtaacgtcttttctttctgcaggctcgagttcatcatgtgaggccaccatg
agtgccttcatgcacactgttgagctgttttcaccggaatggtaggtattacgattgttt
ttgccaatatttaaagatatttacagtattttaattgggtttgtcttgtttttttgtcca
aatatctaaaagttactaaaacaaaaagcgatttctacttgtgaaaaaaaggttttgttt
ccagaattaagctgaaactgtattttttcccgcccaaaaagtaaatcgaagttatttttt
tttatattcacaccgttgttcattttaactgtatccatgtttgtcacgctactttgacta
ttcggtgtaaaattcaatgtaagagtgatttgtaaagcaactatcttatttaattgactg
accgatgtactttcatagtcattaatatctgctaatgtgatttttcccaatttagaatta
acaaatagtacttttctgaacttatacttaaggattaaagcccgaatgtgccaatgttaa
gacaacttacctcagttttttttccccgcgttaaaacaaggtaattgatctgcacgtggc
gcaagtgaaagttttcttaaaaaaacaatgtttacttaaaacactagcttagtgtagctt
ttacttaaaactaacttatttagcttttaaaaagttttcagaaactccaaattaactttc
ttcagtctggaacagtggttctcaaaatgggtgtcgcttgatttccaaaagtcttatgtt
ttattaaactattataattatttcatccataaccgcgagaatataaaaaggtttttaact
tttttatatattttcaacgtagactaaccatgttccgtacacttttcgctattcagcgca
ctcaaacgaccacttctccgtcattgaaagccagataagcatgcttgtgtgttcattctc
tgggggaatacctattgcacaatccaaatcttgattgatgtcttttggaccagtagtttt
tgagaaaagatgggataagtaccgccttcgcatgtgtacggaagatgataggtattaacg
gtgttccgtacacgactaaaatagtgttccgtacagggcgcataactttaatttactggc
aaaaatgggcattgtttgaagtcttattaaaatcctttgtcagaatatactattattgtg
tttaacttgaagttaatgatgtattaaataactccttttatcaaagttttaaatgaaata
gcttcaaaatcatttgctttttatatcatgtttattttattacagcatgacaatttaaaa
tataaaaatattaaattcatgcacatttgaagctaacttgactgaccttttattcattac
tgcaaaaggaggatccaaacagcgtttgcagcctgtctctcaggcggagagttgcgacat
gcgtaatttacccacaattgatgtttaaacatccccatttcaaagcatttatttaacaaa
agatgatttatttaacaatttgtgataacataatattcacttcataaagactgtaatccc
gtgtgatgcataaattaaatgcaaaagcatattgtcggggctttaaatgtctctcctccc
aggcgacactcgcactttaagcttgcccactttctgttttcaagcgcattaggtggacgt
agcaaacttactgaatttactcggcaacatatagtaggaatgtctctgttgtggttgggg
ctgaaagagtgagaattaaagattacacagatttatagcttgcctacgatccataagtat
ttattcagagattaatgttaaaaggtcatctgtacggaacatcgttgtgtacgaaatatg
gttagtctacgttatctatttaattgactgaccgatgtactttcatagtcattaatatct
gctaatgtgttttttttttttttttcccccaatttagaattaacaaataatacttttctg
aacttatacttaaggattaaagcccgaatgtgaaagttaagacaacttacctcagttttt
tcccgcgttaaaacaaggtaattgatctgcacgtggcgcaagtgaaagttttcttaaaaa
acaatgtttacttaaaacactagcttagtgtagcttttacttaaaactaacttgtatagc
ttttaaaaagttttcagaaactccaaattaactttcttcagtctaacgttagaacagtgg
ttctcaaaatgggtgtcgcttgatttcccaaaatcttatgttttattaaactattataat
tattttatccgtaaccgccagaatataaaaaggtttttaactttttttatatatttatta
tacgtttaatatttaatagttgcatttaaaaaatgcaaataaagtcatcagcctttaatt
ttttttttccattggattgcaacctccaaggatatcctagattaacatcacagcagtaca
atgtttaccttttacaccttttatgggtctcgcatgcattaaaaataaaggccaagactg
aacaaggaggaccatctccaagtagctccgtctctgaaatttaaccaagacttgtcttgt
gctataaatattttgtttttctttttcattaagtcagattaatattaataacttgttttt
taaatatattaagtaaacagagtgattataaaaaaaagacttgcacttttgctgacaata
agcttgtttacattgttcctattggttgtgtgtgtgtgcaccatagtgtgcaatgtgtat
gcttctaatcacttccgagcatagagggggtctgagtcactggtgttttaggtgtcacgg
gttgaaaagtttgagagctcctggtctaggaagtgctgcttttaataattttgatatttg
gaccacaaacaagacactaaacacttattcagtgtaaatctgcttgtacatttatccgag
tgtgttctgtgatgaaaacgctatataggaagtgccgtctgatgcgataactgacgatgg
caaagcaaaatctttctgagacgcactaattatacagatatcaggcacacaattcgtttt
aaaaacacattctgaccagtcaccttctttttacaggtgatcatctgcatgtgaacagat
ccaaagtcctgagggtcgaaaccgcacaggtgagcttgtgttgctggagaatagcatgat
ctcggttgctccctcaaagtacaaattaagcaagcgtgtggttgtttggtgctgtttgtg
tatgtgtaaatgagagaccgtgtggtgctgtgtgtccctgtggtgctgtgtgtccctgtg
gtgctgtgtgtccctgtggtgctgtgtgtccctgtggtgctgtgtgtccctgtggtgctg
tgtgtccctgtggtgctgtgtgtccctgtggtgctgtgtgtccctgtggtgctgtgtgtc
cctgtggtgctgtgtgtccctgtggtgctgtgtgtccctgtgtgtttatacagacagctt
gttaaagcccccccaaaataataaaatcaaacattgcgatttttattctgtgacatgcgt
tgcgatatgaaaacaatttcactagacttgaatatctgtttttgtaaaatgtattttaga
tttagtacgagtatacgttcaataaagatacaaaaaaaaaaacctgcttttatttccttt
tagtcttaataccattcaggcatatagtaattgaatcaaatactgcgtggtcttcactct
attcaccttaatcttcgccgacgagcaggcgctgccatttgaatctttttggctggagac
ttccggtctcattcacttccattcatttttagacattaaaaactgctcgtttcgctgttt
gttgcaaactgatatttccttattataatatcctacttggtctctatagtcatgcaaaca
tttgtttgtagagcaagtagtttgaccgttttctgccgtttattattccgattcagtcgc
ctatgggagaaatgactaggaagttcaaagacaatcgcgaaaacggccacacttccgcat
tttagaataaggtcaataaacagtttgatgaaattaatcattgttaaagttacaaacgat
tcaatttctgctttgaatgcttgtaaaatcctcagtcacatgcatcaaaatggcaatatt
atgtattttaatccagattcgacattgcagttcttgcaacgtgactagtgaatgctcact
gtgcgatattaatgtggaaacaatatattgttcagccgtaacttgcagtaaacgcattct
actggactgttttgcttttaatgactgcagaaggcttatttttatttatttttttaatga
aatgaactgctttcaaggacatttctagtgaagtatgaatgggaaagatcttagaattta
tcatgaattaacacaatcctattcgtagcaagaacatttcaacattaatgaatggcaaga
atatttaatctacataatcttttttttttttttttttttttgcccactgaggaaaaatgt
atttccactttgagtgccttggactgatttttgccttattttgttcaatcctttacacga
agagcacagacaaattgtttaagctacccatgatcacttttgtttgggttttaaaactga
ataaaatcaatatgacaaaatgcaaagtagaaatctggaagttacaaatcaagctccatg
tgtgcaacatttgtttgattgcagaggcatcatttttcacgtttttgcattacacgctcc
gtgtgcgggatgtgaagctgtgtgttctgtgatgaaaacgctatataggaagtgccgtct
gatgcgataactgacgatggcaaagcaaaatctttctgagacgcacagatcaagcaaata
taaagtgcatgacagactttagacctctgttctgaccaatcacatgctccttctctctaa
aggtgatcatcagtttggatgcgctccaatgcagaagccctgagggtccagactgcttgg
gtgtgttcgttgctggagaaaatatgtgggacgcctttaaaatggtaatttgaaatatat
ttttataaaataaatatttatttggtgcacttagggtgctttcacacctacacttgtttc
ggaacgtgtctcgtttgcccagttagcgcggtttgtttggcatatgtgaacggggcaatc
gcgcgctctgttccgcgccaaagtaatcgctcagatcgcttgaatgaggtggtctcggct
cgattgaaacgaaccctggagcggttcgattgcagtgagaaagtgatccgatccaagcac
ggttatatcacagtgttttatggatatgtaataggcttacggctatatgaagagacaatt
atgattagggtgggaagtttcgcgagtctccggatgcccgcaaacgagtgatctcccggt
aatctcgcgtctccctccctaccgtgtctctcctcagacgcgtcgcacgcccggcgcgcg
caccctgtcaatcaccaccaaaccaccacctctcctgacagctgagcgggacgctgctaa
aactctgacactctgaccaatttaaggagtttactcgcacgtgacttgttttagctcttt
tggtccaattagaaactttgcagtgtgaaagcgaaccgctccaagagcaaagagcaacaa
tgtaacaattttaatctctgtttcggaacaactgaatcgattcactggtgtgaaagcacc
ctaaagcaaccatgactagtttggtgccagtaaaatcaaatttatggatttttgtttaac
cttttacattttctaaaggtgctgtttaccattagaaaatacaccctttactatagtgcg
taacgagtgttgccctttgactaaaccctgatgaaatactgcaccgtgagggtagtttca
aatccagctccagcgtaacacccccagtgtgctgcatataaagcagtgtgtgtgtgtgtg
tgtgtgtgtgttctttaattacactaagcgacgtgccatctgatgcagtggcaaaatcat
tctgagacacgaggattatacaaatatcgggtctgaatgtgtttttaaagcactgaatct
gattatctgctattttctccacaggtgaacacccacattctgaagccactgggaatctgc
ttctgtaactggttctgaaagagctgacgtcttctgctggacttgaacattcagatgtgc
gtatatttcacatggaaaggtttcttaaaggggtgtaatgtcaatgcttgagtcttgttc
atttttaaggggacggttcacttattattagtagcactttttatttgtttactagttcca
aagctaagtcttgttgaataagtctatcagagcactgtaaacagcacccattgacttcaa
ttagaacaaaagtaaatgaatgtaatggaaatccatggctacccacccccccaatgttgc
tcaagatatttgttcaccagtgaaaccctttacaaccgcttaagtttttaatcttaaatg
gctgtaaggtcaaagctcgagtcaatttatttaatactaatttgtattgtcctcttacac
tccgcacaacagtacatagctgttatggaaccgcaatcacgatgactcgcagcaacaccg
ctgtacaattctttattttcttttaacaactccatttgtcccaaacctgtttgagtttct
tctgaacattaatgaagctatttttaacggagctgttaaaacactcattgatttcaatca
ctttccctcctttactattgattttaatggcagattcttcagaatatcttgtttcgtttt
agaaactctgtttgctatcacttgggcgtgagtgaattggatccattttcattttaggtg
aactgtccctttaagtgttaagtgagcattctgaccctaggtcagtgtttttgcaccctt
tctgttgactaaagcctgtgatgatagaagttatccctgtctgaaaactgtgtggacttc
tggtaacctgaggcttgcctaatgtttacctgtaggacactgttttagttttggtcacta
agctttgccttccactttttttttttttccccaggaatgtgctgtgatttaatattggag
ctgctcgacagtggatcgctgctttcagcagggatgtattgcaccgaacagaactgaaat
ttgccaactttcactgaatggaatcagttttaattgaactagagctacaccagcattata
caccgctctcctgcctgactgatatgctggaacactccgtctgaaatgctgttatggata
tggctgtctgatgctggagtaaagtatattgtgatatgctttgctaaactgagtattttt
caataaatgcagcttcattaaatgacttgaatggcttttcgtttccctttggaaatcttt
attttaggtttttttttttttttttttttttttttttttttttttttttttggctggaca
aatcaaaaaatcctaggaaaatacaaaatggcaaaaaagcaaatgggaattttttttttt
tttttttttttttttccccccccgaagtttttttgttttcaaacccccctttcaaaaatt
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcctctcgaagtctttatg
tattcagacaccactttcaataattgagtttaaaatgacttcagcatttgaagtaggtca
aatttattttgttttgaaaattaagaccactgtaaaaggtttgatcagtcaaatgttgac
tactgtagtctaaaataaggtttcaagcccagtttaagacaaatttcagactttctgaag
tggtcctgttggtgccactaaaaatactgcctcaaaatgaaaggtattgcttggccatgt
gtttaatgtctaaagcaaacaagttgtaaacttaggttcttttctgtctcctagcaatgt
ttcaagtttttaaactcttattttactagtgatggtgtaatgaagctttctgaaccagtg
aacctttccaagtggtgctcgctgcagagccatttgaggagagctgagctccagagaggg
ggagcttaagcttgagctccactttcgactcttgtttaaggaaaaaggttcttttctctg
ctttccaaatcggagctctgaggacctctgctggttgcaaagtgtatgcattgttgcaaa
aatttcaatggttcacaactgaactagtgtagtaatattagtgctgagcaaaactaggct
tcatgatacaaacaggtgaagcacatgtatgttttgaaatccatctcaagtcaatatgta
ttgct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1140, 1231..1300, 4296..4348, 6122..6223, 7284..7375, 8254..8544
NW_003336860.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved