Danio_rerio Locus wu:fc55g01
snOPY snoRNA Orthological Gene Database
Danio_rerio wu:fc55g01
Danio_rerio
wu:fc55g01
7
SNORD31, SNORD26, SNORD29, SNORD30, SNORD22, SNORD31, SNORD31
1930..2000, 3168..3235, 4102..4166, 4330..4399, 4768..4894, 5059..5128, 5268..5341
6697
tattactttgtggttaaatctttatttaatacactagccgttatattgtagttcacaag
ggtggtctcaagaacaaggtttaggtcttcaaatcaatcccatttgtacatttttatttt
tattttatttcaaaaattgttaggaccacagctcctggatcatcacaagatttcacacac
attttatttatttgttaacatcctttctaagattgaatgtaaaaattacagtgtcaaatg
ttactgtagggcttgatcagaaatgaacagaaactgtaacaaaattgtcacctaaattaa
taggaacgctaataaaattcattacaatggcaaaaagtacttgaatgagatttttgtaga
gtatgtggatggaaataactgtgcaacacacttgggcccgaaattcaggtcccagttttt
caaaatatttaacttaatattttaactttaatatttacatatgaacatttctctatttgt
gtttgatttatgcttactccctgcatgtatattttttgtactgttaaaattttatacaaa
aaaaagatgcagatataactccatctagtggaaatgtgaagcctgacaaggttttgacaa
aaaatgttaagcattttatcttcattccaaataataaatctacaaaaagcagatatgttg
ttcgactttgtaagtatgatactctcatatgtgtgttataaatttacctgcctgttcgcg
tccacattgcttttaccatactctgcttaattcatcaatcactactatttatagaacgtg
tatattatgtacagttaacataattttatcaacattttgtgcaaataatcgctctctata
tacagaatatttttaaattcataaacattgaccgactgccatatagactacaacgtattt
ttggcgcttttaatgttatcagattacctgattggttgtcgtcaaatgggcgtgtttttt
acgtgtgacacgaataaaacgcgccgagcccttccttccgtccattttgctacttcttct
tcatcggtaaggattgttctgttcatttccaactggttaaacataacgctattgtgtttt
aatccggttttacaatgatgacataggcgtcaaaaggactgattttcttttgagtatgcg
tttacgtcttttgttatatgggcctttagtagactgctacaatgagtgtacagcccgctg
gcccacgagctttacacttttatctaaagccatcctttttcaactgtgacccttttttga
ttgtttcacattctttgcaaagtttacatgttagtttatcgtaattgctgtctatttcgt
gctacttttgttcttttcgtttttcacgagatctctcaatgatgataactttcacagacc
tgtactgaatcactgtgattgcacaatatttatctgacgtgagatcgagatgatcattgc
atcctttttatcgatttttatttatttatttttttatagttttgcgttgatcgtatgtcc
tgtgctcttatttggaaaacacgtgtttaatgaagggttctcttttgcagcaacgatgac
tactgcgactcgcgtggcatcatgggaaggtaagatttctagcagcctgtagattttgtt
ttttcaatgtgctgtattaagcttaacatgctgtaaaaagaccatttcatcctatttgca
agtttaatacttggtattaaggttggttaagattactttcaaggagcttaacttggagta
ttaatatatttgcagttattatacaaggttttgatgttttgttaatctaatatgatctgt
tatatggtttcacttgatctctaatttatttttgtttttttacaggactgcagtggacct
ttaccccacaacttgtgtccttgagcagaataaggtttgtttgcttccagcacttgttac
ttgtgaacctataggtgtgatgattttagattaccgccccagtctgatttatctgactga
ttggtacccctctgaaccttttgttttaactttttttaaatgtatgttttgaaactcttt
attcatgtagcttttcttttcttttattcagatgctaccagaacttgctgattaactgca
gtcatcttgagcaggtaccctccaaagaaatacgtgcatgttgagaatactcattatata
ttacatcaatttaactcctctgcacaagcatattgaaaccctccaagaagaaattacgat
ttagaaagatctcgatgaaaagtgttattctgcatagcagtctcaatacacttcaatacc
accctgggtttagcagtcagaatgagccctggacattcttactcaacttttctacagtta
atttactgcccacagtgttggggaagttacttttttgaataacccattgcaatttttact
tactcacctcaaagtaattggttgcgttattaatggaaagtaatgtgatgcatttacatg
gagttttcaaaccagccagaggctttatttcttttggaacttgaagcgttttatttatac
ttgtgtttttgtcttgattcagtaaaatcgctgtccaattgagaccataatcccctttat
cccacatgtaaaaaatgagaacttttacagaaatgtaaggctcagtcatccttctgtctg
tacctgcaggagctcattctcgcattgtgattttcaatgccattacactaattcagttta
agaattaatatttaattccactattgagtaatataactttactcgttacttgggtaaagt
agtattattaacatggttttaatcccaaaccccataatatgagatggttctctgcttgca
ccagtctccacatcctgtgcaaatggtaccaactgtagaatgattcaataatgcagacta
accattcttcctggtgtttattggaggttcgcattaagacaaaccattgacttctgtcat
aatttgggaaataagcataaacgttatttagagtgaacattggtttgtggcagacttaat
tactagaactgcttgattgcccccatgtattgtctagtgtgctttgttcgttgtcttgta
ttaaaatcagtttcagtatttttggctctatagacctcagccccctgtgactttttcagt
aaagaatgtccttgtcaggataataactcaaacacatgtcatccagtgctaccatgatga
cttcagaattctctcttcctgaattgctttgatgtaactgttctaacctgagtagcattg
gacatccagattttgttcttgtgatgtttgtaaaacttacttaaacatatttttgttttt
gcagtttccatgcattctgctgggatgaagctgagacgtgttaaattcaaggtaatattg
taaatgtccagtctttattaaaaaaaaaaaacttgttaaatgatgatttccatgacaagc
atatatctgaattccagtgatgtttgcctatttattctgataatctggatgtttccattc
gattttatttttttccttcgttttacagtttttaattttttttttttaaatttttgtttt
taaggattgctgcagaggatgggtttatggcgatcatggacatcttatgggtaagcattc
tcacattcacggtttacttgatcttgtctgaaatgattaagtctttacatcttaactgga
cgacagttttgtcatatggcattctagtcaccaaagtatgatcagatcatgtgacttcgt
aaacaattactgagcagtatttgcacttacaatgcttgtcgtttgactaggtgtttcagc
cttcctcctgttggccatggcacagtgcttttggtaagtttttgacaaaaaaaattgtat
aaagtctctatctgagaggatgaacggtttattccgttttatcatctggacggcattatt
gccccatggcattaaagtcaccaaagcactgatcagacaatgttaaacatgctggagtta
atacatttagcatgcatactaaaggtcttgcctctgtttgtaggtagcactgtcaaatga
ctggttaccaaagaagtggctgtttacttaaaaggtaaattttatgcaaaaattattatt
atttctctctcctccccctcaatctctgtgatgaagaaacttagctcactttgacccaat
gtgaaaagtcacgaacaactgagagattactgtgaatggctaaagttttcattttgcatg
agttgcattgccttttctctaaattccccctcctctctgcaggatccctggttaaagtct
ttgatgggttgagtccttctagcggttttaggtaaggctactacctactttagtttcaag
tccctctgtaacttatgatgattttcattggaatctcgttcgtctgaattcctgctgata
tcttttaaatactgatgttacacaatgcatttattgtagatgttggtttgttcaatgtaa
actaatgtcggtttttgttttccctcaaaggttccagtcaagatgtacacaatggtaaga
atgcttcctaaattttattactagttcaatttgttaatcttgcacctgtgttcttcctgt
aacacatgatgatttagcagtctcgttcgtctgaagtactgttgagaaacctagctttat
actgatgttacaactatcacttgcatgtctgtatttgtcagtttcttccacctaaaagtt
ctcttcactcgtaggcaagacgccttgtctgaagttatccaaacaggtgagttttgttcc
aaacatgtatgccacatttattgacatccttttatgatgcaactcgcacacgtcttacgc
cctgtgtcaatgccagaacctgaaaaggtgaacccactggtgtgtcctgggcaataaggg
gatgatccgttggggtttccaacagtctgagaagcactagttgtagcttggataagtgtt
tatccttcatgtgatccctaacttttttttttttttgttttttttttttttgtgccagga
ctgtagtggaccaaattgtgcatccgtgcagaaagaggtttgtatgcatttggtttcttg
acttgttacttgtgaacctataggcatgatgatcttagattaccgccccagtctgattta
tctgactgattggtacccctctgacctctcttaatgattgttgactgaagtaatttattg
aagcactactaatgtagctttaacttttcagatgctacaaggatttactgatcgattgcc
atcttcatgtacaggtacccacaagttgtacctgttaaagtaaattggtatggacatgat
gagtgactattaccgccccaggctgaaaagttatgactgattggtatcccctctgatcca
tacttgtctaatgcttattttcccgctcccaaccttagtttaactttttttttttttttt
ttttttttttttccccctctagatttcaactgcatgttgctgaaagccttaagagggaga
ggtggacaattttgtacttttcagtgtaatgcaagctcttgctgaaagcagctaagagga
acaaataaatgattttgctgaactctgtctctttgactttagatttatcccaaggtaaca
agtactgtgagttttactattgtgcaagactgacctttttttataagctcaattcattaa
cttaaagaaataataaaccatttatttgtgcaagttgacttttacaccattctcaatttt
cttctgcttaaacttatgggaatcgaataaatatggaccttaatgttcactaataaaaag
tttgactattcatatacttcccctctatttctgctcaagtacttgaatgaaagcaataaa
tcacaacaaagactaaaattgagcaatttgccattcctggtattaatgaaactggtctta
aatcagtttaagcaactagcatgtgtaaagcctcaattttcccaacattacactgtaact
gaaaaaggaaaactgggcacaccatcaattttaatttatggtattgtggctttatacaag
tatatcatttagcagttgtacccatgtcggtgttgcacaatatttgcaaccctcaaattg
tgccacatttaaatttctacaaaatgttctcaaaccaacttgacagctagtttgctagac
acaaaaagggtactgcagattttaatgcaaagtctttttaatggtcttttgtgaagttga
aatccagatctgaaggattcatggaaaaattaactgcccacctatttgtaacatcgataa
gagaaaggcttcactgagctgtaactatttaaacagcagaagctttaaatggaacaagat
accccagcagattttgtgaaacagttgtgtatttatggtaaattagtttttcacagctgc
ttaacaatattttttaagtttgtgaccactatcttcagcacatttgcattacacgtgcag
tccaacatgctgctcctttactgtccatttaaaggctaaatgtgtgtccattagtccgtt
gtaaagatccgagctgcaatatcatctagtagccaatccacacctgaaagcagattctcg
cctgttacagcactgcatcccacaatacaccagtgatgggtcttaatatcatcaagggct
aaaacctaggcagatggagagattaatcagaaactagcatatttacttaatccttatttt
agttgtgacatgcaatgtgaagactcacctctcgaatg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1550..1588, 1845..1893, 2071..2113, 3304..3350, 3544..3589, 3770..3812, 4003..4053, 4242..4290, 4470..4493, 4694..4725, 4978..5016, 5191..5233, 5422..5697
NC_007118.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved