Danio_rerio Locus wu:fc47e11
snOPY snoRNA Orthological Gene Database
Danio_rerio wu:fc47e11
Danio_rerio
wu:fc47e11
1
SNORD60, SNORD60, SNORD60
1433..1520, 2072..2159, 2757..2844
4757
tcgtgggtttcctccgggtgctcaggtttcccccacagtccaaagacatgcggtacagg
tgaattgggtaaattgtccgtagtgtatttgtttgaatgagagtgtattatttgttattg
tttctattaaattattaattaaatgcacagtttattataattcattttcttttttcagtt
tagtccctttattaatctggggtcgccacagtggaatgaaccgccaacttattcagcata
tgttttacgcagcggatgcccttccagccgcaacccatctctgggaaacattcatacaca
ctcacacacactcattcactacggacaatttaacccacccaattcacctgtaccacatct
ttggactggtggggaaactggagcacccagaggaaacctacgcaaatgcagggagaacat
gcaaactccacacagaaacgccaactgacccagccaaggctcgaaccagcaaccttcttg
ctgtgaggcgacagccctacctactgcgaaactgcgtcactagccagttattattattaa
tattaccattaatattattgttattgatcataataatatgtgtgttattgtttttattga
atcatgaattaaatataaagtataatataatttaataacattttatccttattattgtta
ttctaaaaaacttatatatatatatatatatatatatatatatatatatatatatatata
tatatatatattctaatgtgaacatgccattacattttttgccattacattgttatgatt
ttcatgtcaataaaacaagttaaactactcagagggagcgagaaagagatagaggggctt
gttatattaccctaactgcagctgtgttggccaaatttttattgcacagagcctatgcag
ccagcagaggggatgcgtgtactttgaacggatgtttgataccctggtggatggagcaaa
gaagaccgcttataaaagccaggccacaaggttgtttctccctctttgtacggcgatgtt
ggtgttgtgggataagatgattctcttatcggaacggcgctttttgtgtgcaaacatgta
agtaacgttattataatatatgttttaaaatatattttttcattaaacttattaaagaat
acgttaaatcctaccccctatattaaaaccggttgaagatttgggagtacataacaaagt
tacagtttaatatacgtcttaagtgtagtagacttgaaactaatttccgcatttctccat
attcgtttgcagtccgtctcatgatggaggaagcgcatggaaacatggccctggatgatt
ttcgccattgtagtttgtccaacattgaacgcgacgagctttcggtaagtgaactgaggt
tggacaagtaacgttagctaatcatgtaatgtgtcctgttaaacgttattatgagccgat
gatgacttcaatttactttttctgacacctcgtatgaacgctgttattcagcagctgatt
ataaacttaagtctgaggctctttagttttcaaagcttgagattctcactattttggttc
agtttaacagttgttttatttgtcaatcagccatgttgtagtaatttcattaaagtgttt
gtattttaaactatggttaacttgttactattaatgtagactattattttagatctccac
ctttttaaagtttgtattaaataaaaataaaacctaatatttaagtttaagaatttccat
cagatttacatttaaatccaccccttcaaaaattgcaccctcaaatttagcaagccagtt
attataaatttaagtatcaatcgattttttttttctatgaattttctttttctttaacaa
acttgtaactaatgtcagattttttttccacattccagcagttctcattgatgcaagtgc
agaaaaatgccttggaggatttgcaccattgtcatttgcacatgttcaacatctgcattt
gcatctcttaaatcaaacaggacatgaagggttggcggtaagtgaactgagcttggacca
caaatctggtcatgtgataaaataaatgtgagagccgctgatgacttcagtttacttttt
ctgacacctcgtatgaacgctgtaattcagcaactgattattaagtttagtctgaggctc
tttagcttaaagcttggtgtattatcactgttttcagtccttgaaatttaacattaggtt
tatttgtcagtcataatttttttaggaatattattgttagtggtgttggtattgtaaacc
attgctaacttgtggttgctataatgtacggtgtatttagcttttttttttttttttttt
tttttttacctccgcttaagtttggattgaaaaaaatggaatgtccaagtaaattggctt
tatcttcaaggcactattagtgagaattcccttcagttttaaatataaatgcatcccttc
aaaatttacaccctcaaatttagtaaacaagtgactaaatttaagtttgtccatcgactt
aatgtagaactgtatgtcttttccatttaatatacttgtagctgatgtttgtttgtttcc
actttccagcagttctcattgataaaagtgcagaatttcttgaaggatttgctccattgt
catttgtacttgttcaacgcttgcttatgcatgtcacaaatcaaattgaacacgagttga
tggtaagtgaactgagcttggaccacaaatctggtcttgtgatgaaataaatgtgtgagc
cgctgatgacttccattaactttttctgacacctcgtatgaaagctgtatttcagcatct
gattataaacttaagtctgaggctctttagattaatgcttggtttagagttctcacattt
tgggcttggaatgattttggagatgccttaataaatttaaccattttgttgctgtaaacc
tttatgatgtcttggttaatttgttatttattgaccacagttcaggttttaccaattaaa
ctatggtgataacattttgtattattattattaatattgggaatatctgtaaggtagttg
cctatgattgtaacttggagaaagcttatgtggtttgtagagttttagtatttccaaggg
agaaacttatatcaacatgcaagtaaagccctccccacagtccaaaattgtcaagtgact
acaaagttaattaacttaagtgaaatgtgagaactagtgttcggatgttttttttttttt
ttttccctccccaatattaatatgggctttataaccaatataatactttttccagcagtt
ttcatggattaatctgaagttcccaactggaaagtgttttgcaagaggtgagagacttcc
agctcattttgtgccatttttctatccagtcataagcatcactgacttattgtagtgaga
ctgttcttaccttgataattgtagcacattgcagtgatgagaaaccgtttgctaagctga
tccatgattattggttctgattgtaaactctctccctgagctcttttaaagaaatgcttc
gttttggtttcgactccggcacaaactcaatatacttgtctttttatttgcagatgtggg
aagaccaaaaagtcagtctggaggtctgcagtttggaatatgaagtcctgtttttccaca
aatgccaatgttggaaaatatttattcatttttaaccacatgttgtttgagttgatgctt
gttaatagaagctgttgccaaatatgcatcgtatttctataaagcagttgagtatctggt
ggtttgtatgatatattgagctgtaggccatgtcataattttgtaaaatatgatgtgatc
cttaattattgtctgatcctggaaaaagtaatctatagctattccctatcctcaacttaa
ataagtgtaagaaacttccaaaaccaaaggtgaataatagttggattaagcatatgtgcg
taaatcaaacctagccttaacttaaaccctaaatgtatcttctaattctgattggattgt
taaagtatgaacatggatgctactctaggaatatgtcctacttgttgaaatcaggttggt
ggcaagtaaacctgaaaatatcactagtttgtgcccaagtgataactggtggtttaatat
cattacaaattcatttttctatagtgttaagcagtcgatttttaaaatggaagctctagc
aaattgaatccgcgtttgtcctgatttcagaattggagttaagtctagtttagtagaagt
cttatttaatacctcagtttgcatatgtctagtgcctgctgtttttaaagcataatataa
accgtcctccatcctacacggatgatccactccagacgtttctgactgcagggagacccg
ttacatgcgctccacttccggattattgctcgtaatgatcgctccgctgtgtggttcatc
actcggatgatgttccagagcttgtgcatttaatacatcagtcagtcgctcatagacgac
tacaataagctccaaaagctgcattttcccgacgttttcatctagactcgtcgaactgtt
ttattgcacgcgtttaaatgaaacttgtaaggtaagtaaatgtgggagataaaccggggg
gagatgtgttgatgtaaattgagttttgaatggagccagtaaggcgttataaacaatgtc
gcttttgtgacacccacgcaacacagaatggcgttaatgtgtttgcgtcgtgcatttaaa
tctttaatgttcaaactg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1272..1363, 1898..2016, 2589..2701, 3295..3346, 3593..3757
NC_007112.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved