Ciona_savignyi Locus ENSCSAVG00000011193
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000011193
Ciona_savignyi
ENSCSAVG00000011193
reftig_9
SNORD111
1297..1378
6022
GTCTTTGCGTGTCAAAAAGTTCCTACAAATATTTTGAATTTATAGCTTTTGTTGAATGT
AAAGGGGTTTGTTGGGTTTTCAACACCAAAGTCAAGTTAACATAGCAGTGGCATTGCGAT
AAAACCCATTTGAAGATCAAATTGCTTCCAAGCACATAACGCACTAGTAGTCTGACAAAC
GATGTGTAATCCACTAGGTAAATTGCTTTTATCAATACCAATACTACATTGCAGCTTGTA
CACTGTAATATCTTTATACTTCAACTTGAGGTCAAATTAATTAAAACTTGACTTGGATAA
AGTCACACCAGTCAAAGGACTTACTTATTTTTGAAAACTAAATAAATAAGACCTTATTCA
ATGTTTGTTTGGGCATGTGAGTAAATATCAACTAATTCGGCGATAAATCATGTAGTTAAA
TCGTTAATACATTACTGAGCAGTGTGTTTATGTTTACTAAATTAGTATTTTACAGAAAGC
AATATTGCAAAAGTAAATTTAATGTTAGTTCTCACCGCAAATGTTCTTCTATTTCTGCTG
TTGGCGTATCTTTTTCAACGACCATAAAATTCGGCTGTCTGTTTTTATTTAGCTCACCAA
TTCCGCCAAGCAAAAATCCTGTGCATGTATCTTCGTCCCCTATTACTGCTAGTAGTTTCC
CTGCTCTTGTCACGGCCATCTTAATGTTTTGACAACGAAATAGAGGATGAATGTGATGAA
TTCTTAAGGCATAACAGACGAAAATTTGCTGACTATCATATGATGATGACTCATCAACCG
GTTTGGAAATAAAAATAACAAAATTTATTTTAAATTTTTTGTTTTAACCAAATTGAACTT
AATTCAAGCATAATTTAATTTTTTTTAATTACTTAATATATTTGTGGATTTATTTTATTA
CATCATTTTTTATTTATTGCAAAACTAATTCGCAATAACATAAATAATGCCGCGTCATGG
TCATCCGGGTAAGTTTCTTTTAAAAAGGCTGTGTCATTCCTTTCCAACAGAGCAGGTACG
TGAAGTATAGTGTTTGTTCTTTTGAATTATATCTTCCTTAATCTGGTTACTAGAGGTGTG
TTATAGTAAGTTGTTGATAGAAACTTGTCAATAAACTAGCGCTTATTTTGTTTTTCAGGC
AAAATGGGTCGCCGTCCAGCTCGATGGTAAGTTTTGTAACCTGTAAAATATGTATATCAT
TCACTTCGCCTCCACAACATTTAGAGAATAACAGTGTAGTTAGTTTAAAGCAAACGTTAT
TTAATCTAATTTCTCCACATGCCAAGATATAGGCTTTGTGATTACAATGATGATTTTACA
CATGTCTCTTCTCTGATTAAAAATGAAACGATACATTTTTATACTTTCTGAGTAATCACA
AGTTTTTTAGTTAATTCTAAGAGATGAGAGTATTGATGAAAACTAAAAGGATGAAACTGC
ACACCAAAATTAGAGTTCTGTGGTTGAAATTAGTGTTTGCTGCAGGGTTAGAATTAGAGC
TGCAACGATAATCGCTTGGGTATTTTACCATAGACGCATTATTTTATTAGGGGATCTTTG
CATAAAAATGTGATTCGAATATTGTAAAATTAGCTGTTATGCACTTACAACCACATTATG
TTGAACACACTTTGTAACATTTGTTTTTCTGGTGTAACAATCGCAATAAACTGTAGTCCT
ATGCCTATCATAGGGATGCACAATATAGGATACTTAGGTATTCTAGAATATTCTAGAATA
ATACATTTCGAATCTAGAATTTCGAATCCTATTCTAGAATGTTTTACTGTTTATTTAAAT
TTGCTACGATGTACAAATATTTTCCCATTAAAAAAAAGATACTGGGAAGTATATGAATAT
TAATTAAGTGTAGAGAACTAGCAATATGCTCTATACAGTGTTCAGAGAAATTTAGGACTT
ACTCAATCAACATTCCCCCATAACTTAAGTTTTCATTGAAAAGTGTATTAAATTAATTAC
TATAAATTCAACAAAAATAATAACTGAATATTTTAGATTTTATTTTTTATGCTAGTTCAA
AACATAGTTGTTAAAGTGGAATAAATATTTCCAAAAATAAGTCTGTCTAGTCTTTAAATA
ACTTTCCAATAATTGCGTCATATTTAAAGGTGCAATAAACCACGTGATTAGCGCGGGGAA
AGTGACCTACTTTCTTTGTGTGTGCGCGCACTTCAAGCGCGTCGTATGGGACGCAAAAGA
TAACGAATCGTGCTTATCTATTGTCGCACGCATGTTGAGACGTTGCGCTGACGTTTGCAT
AATTGAAGGAACGATTTTTGTTGAGCGATGAATCGCAACCGCGATTTTACGTTTATAATT
TCGAATCCTAACTATTCTTATTAAATTGCTTATAAAGATTCGAATCCCTAGAGATTCGAA
TCTTAAAGATTCGTAATTCTATATTGTGCATCCCTAGCCTATCATTATGTATTATTTGGG
CTAAAGTTAACTTGCCTTACATAGCATAACTTTACATTGTATTACTAAAGTTTAGTAATC
AATGTGTGAATTTTGTTAAGTGTAATTGAAGTTAACTAGAAAAACTTTATTATGATTGCA
ATATATACGATCTACACTGATGTATCGTTGCAGCCCTAGTTAGAATTAGTTTCCATTGTA
TCAGTGAGCTGTTTTCCTCTTTTTTTAAAGATCCCGTAAACCCTAAAGCTGTTATGATTA
GTAAATACCAAAATTGTAAATTTAACACCATTAGAGATTATAATATAATCTTCATAATTG
TTTCCTTTTGTAGTGCCCGTTGGTCCTATTATCTTATTATAAGTAAAATTAAAATTAGCA
TGATTTAAAATCCATTACCGATAGTCGAAAGGAAAAATTAGTACTGATAAAAGACCGCAT
GACTGAACAATTTACATTATATAAAATTTCCATTTCAGTTACCGGTATTGTAAAAACAAG
CCGTACCCGAAATCACGTTTCTGCCGTGGTGTTCCGGATCCAAAGATCCGAATCTTCGAT
CTCGGACGAAAACGAGCAGATGTGAGGGATTTTCCATTATGTCTCCATATGGTGTCTGAT
GAGCTTGAGCAACTCAGTTCTGAAGCACTGGAAGCTGCTCGAATTTGCGCGAACAAGTAT
GTGGACATGTCTGTGGTAGTATTTTTTTCACTCTTGTGTCTTGTTTTATATATAACTGGG
TTGTTTGTATTAAGACATGGCCGTTTGTTACTTTTCTTGAACTTTCAAATCTTAAAGATA
CCTTTTATATTTTAAAAGTTATATATATATTTGAAACAAACTAATATATTGATAAAATGT
CACAGTGATGATTAGTTTTTCTTGATTGTAAATGAAGAGTAACCCAACTTAACTCTCTCT
ATCTGAGTGACATTTAACCAAAGTTAAAAATTTACAAATAAGTTTGCTCCTCGTCATTTG
TATGTTAGTAAACAAAGAAATCCACTAAGTGTTTGGCCAGTTGTAAAAATATTATGGTAA
GGACAAGGTTTTTATGTCGGTATTACGTATTAGTATGGGTATAATTATAATGTTTAAGTG
ATTTTTAGTTCGTGTTCCTCCCCTGGCACATCTGATTAAGCTATTATCTATCATTTCAAT
CATGTATAATCTATGGAATGTATCAGGAACTGAATATGCAGATTGACCATCTAGCTCCTT
AAACAAATGTTTAGCTCCAACCCCTTACAGGTACATGGTAAAGTACTGCGGTAAAGATTC
ATTTCATTTACGAATTCGTGTCCATCCTTTCCATGTGGTTCGTATCAACAAAATGTTGTC
ATGTGCTGGAGCCGATAGGTGAGTGAATTGCAACTAATGCTCTGTTCCAAAAGGTCACAA
TGCTCCACATTTTTTTCATAGTTTTCAAATAGTTTGTTTTGGTTGAATCTTGAATGTCAC
AGTGATGATTAGTTTTTCTTGACTGTAAGTGAAGATCAACCGAACTTAACTCTCTCTATC
TGAGTGACATTTTACTTTTTTTTATCTGACTAAAAATATTTGACAATGTATTGTGCATGA
GGGGAACAAGTAGTCTAGCCACTCTGTCAGTTAGCACGGTAAACTTCGTTTAATCCCTCA
GTCTTGAAAAAATTTTCAACACTGATATTTGTAAAAATACATAACCACAGTCAAGTTGCA
AAAGCCATTTTCAAAATTGTATTGCATATTTAAAGAAGGTACTTAGTTATTTTTAAAATA
CACTTCAAGCATTCTGTGGATATGCCTAAATGCTAATATTAGACTGGCATACAAGTATCA
ACTAGCAAGCAGTTGGTTTAAACCTCTATATATTTACATATTTGACCAAACCATTTAAAT
AAGTATAACTATTCATTTATAAACAATCAATCAAACTTTTTCTGCAGGCTCCAGACTGGT
ATGAGAGGAGCGTACGGCAAACCGCAAGGTTTAGTGGCACGCGTGAAGATTGGTCAACCC
ATCATGTCGATGAGGTGCAAGGACAACTCTCGAGGTCATGCTATTGAAGCTCTCCGTCGT
GCAAAGTTCAAGTTCCCTGGTCGACAAAAGGTGCTTAAAATGTTTTTTTTTTATTTTTTA
CCTAAATGCTCTGATTTATGTTTTTATTAGACCCATCATGTTCACACATTCGTTATCTGT
TATACGTATTTGTGTGTATAAAACCGTTTACTTAGTTAACGAGTTAATGTTTGTTTAGAC
AGAGTTGTGTCAAATGCTTTTATTTCCCATGATCGCAATGATGTTAACTACATGTCTCTT
CTCTGAAAAATTCTATGAAGAGTAATTGTTTCAGTTCTGAGTGATCTGTTAAGAGTTTCA
ATTTTTTCCTTAAAATCAAGTCAGATTACGAATTGAAGTCCCTCCATCAAATTCCATCCA
TCTTCCTCAGATCTACGACTCCCCGAAGTGGGGCTTTACAAAGTGGAATCGTGATGATTA
CGAACGAATGTTGGCGGAAGGTCTTCTAATTCCTGATGGCGTCTCCTGCCAATACAAACC
CAACAAGGGAAAGTTGTCCCATTGGAAGGCTCGACAGTAATCAATGGCGAATAAAATATC
AGATATTGAAATCAGTTTTTGTTTTTTGAAATTCACGTTTGTTTAAGCCAACTTGTGTTG
TTATTGAAAAGGTAAAATAATGAGATATTGCAAGGTGTCACAAAGAATGTGGTTTTTGGT
AGACTACCGTTTAAATAATTATGTACTTGAAATCTTATATCCAGATTGTTATACACCAGG
AGGGTCAGAAAAAATTTTGTTAGCTTTTAACAAGATTACCCAAATTTAAAATAAGTTTTA
AAAATATGCTCACTTTTTATGGATCCCATTTGAAAAAATGGGACACATATTGTTTTTGTC
CGTTTTTTTTTTCTTTTTTTTTTTTTTTGTCAAACGCTTGACAGACATGGCTTGTGGCCC
CGACATCTACCAGACAGGATAACAGAATCGCAATGAAACTTTGTCATTTGTTAGACCACA
TACTCTATATGAGCAGAAACCAAAATTTTGGGTAATATACCTAGGGGAATTCCCCTGGGG
GTTAAAAAACCAAAACGGTATTTTTTTCAAAATTTTTAGCTTTTTTGGGCATAGCGCTTG
AACGGCTGCTCCAATTTTAATCAGATTTGGTGGAATGTAAGCAATTAGTCACTTATTTAA
CACCTAAAGAAAATAACACATCTACCAAAACGAGTAATGGAATCGCAATAAAAATTTGAC
GTTTGTAAGAGAACATAGTCTAAATATGCAGAAACTATACTTTTGGGTAATGAATCCAGG
GGAATTCCCCTGAGACGTTAAAAACCAAAACGTTTTTCTAATAAATTTTCTTTTTGGGGC
ATAGCGCTTGGCTGCTTCAATTTTGATCAGATTTGGTGAAATGTTAGACCATTAAACACT
CTGAGTCAATTTATTAAAACAAAAAAACATTTACTTAGGGTAATTCCCTTAAAAACGAAA
ATACGATCTTGAAATATGACTGTGACAGACATGCCATATCGCGCTGACATATCCAACAAG
GAGTCGGCAAATCGGAATAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1138..1165, 2918..3115, 3690..3797, 4367..4529, 4870..5022
1143..1165, 2918..3115, 3690..3797, 4367..4529, 4870..5016
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved