Ciona_savignyi Locus ENSCSAVG00000002010
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000002010
Ciona_savignyi
ENSCSAVG00000002010
reftig_5
SNORD18, SNORD18, SNORD18, SNORD18
2710..2779, 3401..3470, 4995..5064, 5309..5378
6677
AACCTAAAATTATATGCTACAAGTTTACAACTTACTATTTACACTTACGAACTGTTGTA
TTACTAGCTTGCCATTTTTTTTATAAAATTTCTAAACTATATGTTGAATTATGCAATTAA
AATTAAACAAATCGAAAGCTAAAATAACACATGTATTCATTCACAAGAGAAACAAATTAT
ATGGGGGGAAATCCCCTATTTTAGCAAAATGAAGGCATCAACCATCAAGTATTGAATTTA
AAGTTTGAACGAATTTGAATTTTTACACACAATATATTGAAAAAATATAAAAAAAATGCT
ATTTTAAAATTTTTTTTAATTAAATACTGTCATATTTATTTTAATTTTACAAATATTGAA
ACAGACTGGGGTGTAAAAACAATGTAATAGCTAGATCTTTATGTTAAGCGTATATTCATC
CGCTTAAAAATGTTTTGTATAATATCTACTTATATTTTCCATAATGTTAGAAAATATTAA
GTTAAAAATATGTTTTTCATTATTTAAAAATACTTTATATCTGTTCAAATTATAATTTGT
ATTTATTTTAATACCTGTTAAATCGCGCTATTTCCACCACATTTTGCATATATCCGCCAC
GTGGTGTCCCTTCTTTCTTTTCTTCAGCGACCATACCGGTTTGCTGTACGTATTTGTGAG
TTAAAATGGTACGTAGATTTTGCTTATTTACACCTTTTACAATGATAAATTTACCTAGAA
CTACGAATAATCTTCGTTTATATTCTTATATGGAATCATTATCGTTTTAATTCCAGATTT
TAGCGCATGATATAAGTCGAGATTAAGGCGTGTTGTTACTATTATTCACCTATAAACCTA
TTTTACCATGTGTTCGTCTAATAGCTTTATTTCTCTATATGATATTAGACTACTTTAGTG
TAGTGAAATGTGTGATTCATTTAATGGCACATAATCCTTTTACTTAAAGGCATAAAATGC
AATGTCTATAAAGAAAAAAGTTAATTTGCTTTATTCCATAGGCTTGCGCACGGCCGTTAG
TGTCCGTGTATTCGGACAAAGGAGCAGCTTCTGGAAACACGATAACTTTACCGGCAGTGT
TCAAAGCGCCGATACGTCCCGATATCGTCAACTTTGTTCACACCAATATAAGCAAGAATC
ACCGGCAACCTTATGCCGTGAACAGGTTTGCTGGAGAACAAACAAGTGCTGAGTCATGGG
GAACTGGTCGCGCCGTCGCCAGAATTCCAAGAGTAAGGTAATGTGTGTGGAAGTTTTTAA
CTAAATTCTGATTGATTGAAACATTTAAAACTTAATGCTGGTGTGGTAGGTAAAATTATT
TTATACAAGGTTAAACAACAGTACACAACTAATATCTTACTGTCCACCATAACGATGTGT
CATTTAATGTGATTTGTAGTTTTGTTGCTTTTTAATTTTTCGGGTGCCTCTAAATACCAC
AGAATCGCTTGGAGCGGTTGGATTACTTGGATCATTAAGATTGCTATGGAAAATAATTCT
AACTCTGTCCCAAACACTAATCTCAACCCCAATACTAACTTTAACCCCTACCCTAACATT
AATATGATGGCTTTGGTGGTTACTAAGTATAGTAAGAGTTTCAAGCGTTCCAGGCGGTTC
TGTAGTATTTAGAGGTACCAAATTTTCCTGCCATTTTAAGTAAAAGTTCATTAAAGAGGA
ACATTTTTCTTACTGCACAGCGGGAGTTTTAGCTTCATAAAACTTCCTGTAATAAAACTT
ACTTTGGCGTGCGTGGTAGATGATTTTATAATTAACAATCAAGAAATACAAACCCTCTTC
TTTAGTGCGAGTTAAGGCCAGTAAATCAAAATGATGAGTTTTGCTTCAGGTCCGTGTTTT
TGATATTACTTGATAGCAATTGAAGTTCTGATGATTTACTGGCATCTAGAAATATACTTT
AAAAAAGGTCACCAAGAAAACTGCCTGGTTCATTGGTTAACGAACTTTCCTAGCTTGCTG
CGAGCAATAAACATCGGTAGTTTAATAAATATGGTTGTATGATATCTAATACTTTGTTAG
ATATTAGCATATATTTAGTTATTTTATCATGAATTAGGCCTGAAAGTTCACAGGTTGCAG
TAATGTTATTTTCGATTCATGCAAAATTAATATGTCATCATTTAGTGATTCGAACTAAGA
ACAACTAAACACGTGATATATATTGATCCTTAATATTTCTTGATGTTATAGCTTTTTGGT
TACGCAAGGACCTTTAGTATCCATGTCATCTCATTTAAATTATGCTTTAATTTAATTCCT
ATGCGACATAAGGTGATTAAGTTTACGTATAATATTGATCGTTATTAATGTTTCTTGAAA
TGTAGCAAGGAAACTCCCTATCCATTTTTCATTAACTTTGCTCTAATATAAGTCCTACCT
GACATTGGGTGATTAAATTATTCACTTTAACAGGGGGTGGTGGTACCCATCGCTCGGGAC
AAGCAGCGTTCGGTAAACATGTGCCGTGGTGGTCGAATGTACGCTCCGACGAAAACCTGG
AGGCGTTGGCATCGTCGTTGTAACATCAATCAGCGTCGATTCGCTGTTTGTTCCGCTCTC
GCCGCGTCTGCTCTTCCAGCTCTTGTCATGTCGAAAGGCAAGTGTTTTTATTTACAGAGT
ATAGTTTTTCACTGTATTCTAAAGAGATATATATTTCCCGTTTCATAAATACCAAATTTT
TGCTACGGATTTGAAATGATGAGCTACGCTTCAGGTCCGTGTTTTTGACACTTCTTGATA
TCAATTGAAGTTCTGATCATACTTTCAATGCATAAACATACTCTCATCTTGTTAAGTGAA
TATTTTCGTTTCATTTGGTGTATATTTTTATTTCTTGAGAGGCATGTTAGCAGTTAATCC
CAGTAGATTCGGAAAAGTAGACTGTTCGTTAAACCAATAAACATCTGAAAATGTGCATAA
CAAAAACTGTGCTTCACAGGTCACAAGATCGATCAAACCCCAGAGATCCCTCTAGTGGTT
GAGGACAAGGTCCAGCAGTTCAAGAAAACGAAGGAAGCAGTCGTCCTGCTCAAAAAGTTG
AAGGCATGGGATGATATTAAGAAGGTTTGTATTTATATATGTTAATGTTATTGACATTTA
ATTAAGCAGTGGGCATGCTTTACTACTTATTCTTCTACAGATATTTATATCATCAAATTG
TTTTTAATTTAATGTATGTATTTTATTGTAATATCCTTGTGTATAACTGGAAAGTCTGAT
CTAGATTTTTAAAACTGTTTATAATTCAAACTAGTGCCAGAACACGGCTGTGTTATCATT
TTACTAACTGTCACAACCTAAATGAACGTATGTTAATTTTTTTAATCGTTTGACTAACCT
TTGGTGCTTTAGTAGTATTATATTAATTCTGAGCCAGTAAAGCAAAATGATGAGATTTGC
TTCAGGTCCGTGTTTTTGATTTTACTTGATAGCAATTGAAGTTCTGATGATTTACTGGCA
TCTAAAAATTTCATTCCTAGTCGCATGTACTTTATTGCAAATTTGTGAATGACGGTTGTT
AGTCAATGTACCAAAAACGTTCTAAAACACCAACCCTTTTTTTATTTATTAATTTTCATG
CAACAACTCTGCTGTCGCTTACATTAACTTAAGTTATCCAGATAATTGAAGATATAGAAA
CCGATTTTTAACATTTTCCTCTTGTAAACCAACCCCTTAAAATATACAACATTTAATATT
TTTAAGCCAGAATGGACCAAAACTATCAATTCCTGTTTTCTGAACTTCCTAATGCTTATG
GGCAATAAGAAAAAGATTAAAATTCGCGCAGGTGATGAAATCTCGACGTATCCGAGCAGG
CAAAGGAAAGTTGAGGAATCGTCGTCACACGATGAAGCGTGGTCCTTGCGTCATCTACGA
TCAAGATGAGGGAATCACCAAGGCTTTCAGGAACATCCCAGGTAGCCTCCTAGTATTCTT
ATTCATGACCTAAAATCCATCAAATTTTGGGCAAGTAAAAATTCACTTGCATGTGGAAGC
TTGAGCAAGTAATCCCAGGTAGCCTAGTGTTCTTATTAATTTCAGATAATAATAAGAATA
TTGCAGTTTATCATGTGATAACCTGAATACACCCTCCCTATATTTATTTTGTTGGTCTCT
TTCACTCAACATTGGTTATTGATAAATAAAATTCTCTGTATAAAGGAAAAATTTGGTATT
TTTTTTATTGTAGAAACAAAAAGTTGGATATTACTTTCATTTTATTGGTCCTTTTTCGTG
TTTTACCTAACATTACGAGCATAATTGATAACAATAAAATTCTCTGTATACATGGGAAAT
TGGATTAAATTATGCATATTTTTTTAAAATCAATCTCATTTAATTGCTCCGCGTAAGTCT
ATTGGCAATACTAGGCAATAGACACCAACAAAATCTCAACTACATACAGTCAATTTACTT
CAATTACAAACCTTTTTCAACCCCGTGGTCTGCTCTGATCATGCACTTCTATCGTGATTA
GGTTTCATACATGGGGAAAATTATATTTGTACAAGAGTGTGGTGCAGAGAAATTGCTTTG
CATCTAATCTTTTGTGCATAACATTGATACATTAGTATAATGAATTATACCTGTCCATTA
AACCTTACAGATAGATAAAGCACATTCAGTGACTATATATTGGTTGGTTGTTTTTTTGCA
GTTACTCTTGCTTGTGTCTTCCAGATGACCTTCTAAAGGACTGTCTAAACCTATCAAATA
ACATTGTTTGCAATATTTTGTAATTACAATAGCTAGAACTCTTGTTTTTTTTGATGGCGT
AGTAGTCTATTTTAAGTGTTAAATTATGCACAAGTCTATTAACCAATGTATTTATGTCCA
GGCATCACCTTAATCAGTGTGGATCGATTAAATTTGCTGAAGATTGCCCCTGGTGGTCAC
GTCGGTAGATTCTTGATCTGGACCGAGAGTGCTTTGAAGTAAGTTTTTGTTCAAATTAAT
ACGTTTTTTTAGTATTTAAAATGATGAGATTTGCTTCAGGTCCGTGTTTTTGATTTTACT
TGATAGCAATTGAAGTTCTGATGATTTAATTCAAGGTTTCAGTGTTAATTTCAGCAGATT
TGCGGTTTTAAAATGCATTTTTGTCATAGACGCTTAGATGCCATATATGGCACCTGGAAA
AAGCCGTCTTCAGAGAAGACCGGATACAATCTTCCGATGCCAAAGATGACCTGCACTGAC
CTGAGCAAGATCTTGCAATCTTCTGAAGTAAAGTCAGCGCTTCGAGCGCCAAAGTATGTT
GTTCTGTATATTTGGTGTTTCGTAACCTTGTTATATGATGAGATAAACTTCAGGTCCGTG
TTTCTGAAACCCAATGAAAACAAATGAAGTTCTGAAAGTATTTTTTTTTAAAAGTTTGAC
GATTGGCGGTTCTTTTGGTGCTAATACCGTTGTTCCGTCGCAGGAGGGGAATAGCCCGTT
CCTCACAGAAGAAGAATCCACTGAAGAACATCCGTGCAATGTTGAAACTCAACCCAGCGG
CAGCATCGGCCAAGAGGTCCGCCATCTTGACGCAACAGCGTCGTATAAAGGAGAAAGCCG
AGAAGAGGGCTAAGAAGGCCGCCGGCGTAATTGTACTGACATTATTCAATAAAGTACAGT
CACAGAACTTGGTTTGTGGTCAAGTCTTACTGGTATAGTCGAAGGGTGGTAGGATCAGTT
TACTAGCCAGTCAGTTGTGCGATAGGGCAAGGCAGTTAACGTACATCGCCGGACCCCAGT
GGATTAATAAATTTCGAGTTAATCGGTAATCCTGTTAACCAGCTAATCTTCATCATTACA
AATGATAACACAACTTGCGTTTTCCCATTCGCGGGATACAACACGAAACACTGTTGCACT
AGTACATGAAATTTGGTAACTTTAAAAAATGACAAAACCGTATAATCATGCGAACGGCAG
AAGCCATTGTAAAGTATGTTGTATTTGATTTAATAGTGCTAATATTTTAATCACGCTGAT
AAAGAAATACTACTAGTTCCTATTCTCAAATTGGGTGCAATTTCCCTTTTTTATCAAAAT
AATAACTTGATATGCTGCATTAAAAAACAACCACACGGAATAGTTATAATACAAATGACC
TGGATCGTTTTCGAAAATATTGAACTAGAGAGTGTGAACCACCACTATTTTTAAATTCCC
TATTCTGTACGATATATTTTTCTGCATGAAGAAATGATCGGTTTCTGTGATTACCAGATC
ATTCCGGTGTATCTGATACAAAGAGTATATTTATTGTTTCTGCAAGCAGAAACTAAAGGG
TTCCCGAGTTACCAATTCAAACTTAATATCCATGTTTTATGAATAAAGTATTTAAGTTAG
AAGTTTAATGAATTCTCGGATTAACGTGCGGTGTGTAGGCTCCGTTTCTCATATCTTAAT
TTATTTTATTCACCTACAATTTTCCTTACAATATAAAGTAAATAATCTTTAACAGTTTCG
AAATATCGGTTTTTATGGAATAACCGGTGCCGAACATTCGCAAAACGGCAGCTGTGCTTA
TATTCTTGCGTCTATCGGGAATTTACCTGACGCAATATACCTAGAATTTTGCCACTGTAG
ATCCAAACCATATCAGCTAACACCACCAGAAGATTTAACTTGATTAAACATTTTCTTTCT
TATTATATAAATCGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1231, 1849..1852, 2433..2470, 2475..2622, 2959..3083, 3811..3940, 4861..4957, 5129..5272, 5443..5677
1001..1231, 1849..1852, 2433..2470, 2475..2622, 2959..3083, 3811..3940, 4861..4957, 5129..5272, 5443..5674
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved